Candida kefyr (Beijerinck) van Uden et Buckley (ATCC® 2512)

Strain Designations: [BI CZAS 652/6, CCY 29-8-9]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Torula cremoris Hammer et Cordes
Strain Designations [BI CZAS 652/6, CCY 29-8-9]
Application
Assay of nicotinic acid niacin
Quality control strain
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Morphology After 3 days on YM agar at 25°C, the cells are globose, ellipsoidal to cylindrical, 2-6 x 3-11 µm, and occur singly, in pairs or in short chains. Growth is butyrous, glossy, cream colored to brown.
Sequenced Data
26S ribosomal RNA gene, partial sequence

CATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTCGACGTCCGAGTTGTAATTTGAAGAAGGCGACTTTGTAGCTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTGTGGCGAGGATCCCAGTTATTTGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGCGTTTGCTTCGGCTTTCGCTGGGCCAGCATCAGTTTTAGCGGTTGGATAAATCCTCGGGAATGTGGCTCTGCTTCGGTAGAGTGTTATAGCCCGTGGGAATACAGCCAGCTGGGACTGAGGATTGCGACTTTTGTCACGGATGCTGGCGTAATGGTTAAATGCCGC

Morphology After 3 days on YM agar at 25°C, the cells are globose, ellipsoidal to cylindrical, 2-6 x 3-11 µm, and occur singly, in pairs or in short chains. Growth is butyrous, glossy, cream colored to brown.
Name of Depositor FW Tanner
Isolation Not known.
References

Espinel-Ingroff A, et al. Comparison of RapID yeast plus system with API 20C system for identification of common, new, and emerging yeast pathogens. J. Clin. Microbiol. 36: 883-886, 1998. PubMed: 9542903

Winter WD Jr., et al. Nicotinic acid requirements of Candida pseudotropicalis. J. Bacteriol. 82: 616, 1961. PubMed: 13893828

Williams WL. Yeast microbiological method for determination of nicotinic acid. J. Biol. Chem. 166: 397-406, 1946.

YT MicroPlate QC Set. Biolog.

RapID™ Yeast PLUS QC Set. Remel™.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation