Candida tropicalis (Castellani) Berkhout (ATCC® 200956)

Strain Designations: MY1012  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations MY1012
Application
Susceptibility testing
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Amphotericin B-resistant
Morphology After 3 days at 35°C colonies are cream-coloured, smooth, dull, with a mycelial border forming after prolonged incubation. Yeast cells globose to short-ovoid to long-ovoid 3.0-5.5 x 4.0-9.0 µm, single or budding.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TTAATTGCACCACATGTGTTTTTTATTGAACAAATTTCTTTGGTGGCGGGAGCAATCCTACCGCCAGAGGTTATAACTAAACCAAACTTTTTATTTACAGTCAAACTTGATTTATTATTACAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCCCGGGTTTGGTGTTGAGCAATACGCTAGGTTTGTTTGAAAGAATTTAACGTGGAAACTTATTTTAAGCGACTTAGGTTTATCCAAAAACGCTTATTTTGCTAGTGGCCACCACAATTTATTTCATAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGATCCAGGCCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTTCTTCGGGGGTGGCCTCTACAGTTTATCGGGCCAGCATCAGTTTGGGCGGTAGGAGAATTGCGTTGGAATGTGGCACGGCTTCGGTTGTGTGTTATAGCCTTCGTCGATACTGCCAGCCTAGACTGAGGACTGCGGTTTATACCTAGGATGTTGGCATAATGATCTTAAGTCGC

Morphology After 3 days at 35°C colonies are cream-coloured, smooth, dull, with a mycelial border forming after prolonged incubation. Yeast cells globose to short-ovoid to long-ovoid 3.0-5.5 x 4.0-9.0 µm, single or budding.
Name of Depositor M Lozano-chiu
Special Collection NCRR Contract
References

Rex JH, et al. Detection of amphortericin B-resistant Candida isolates in a broth-based system. Antimicrob. Agents Chemother. 39: 906-909, 1995. PubMed: 7785993

Lozano-Chiu M, et al. Lot-to-lot variability of antibiotic medium 3 used for testing susceptibility of Candida isolates to amphotericin B. J. Clin. Microbiol. 35: 270-272, 1997. PubMed: 8968923

Wanger A, et al. Comparison of Etest and National Committee for Clinical Laboratory Standards broth macrodilution method for antifungal susceptibility testing: enhanced ability to detect amphotericin B-resistant Candida isolates. Antimicrob. Agents Chemother. 39: 2520-2522, 1995. PubMed: 8585737

Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts; Approved Standard - 2nd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M27-A3.

Forastiero A, et al. Candida tropicalis antifungal cross-resistance is related to different azole target (Erg11p) modifications. Antimicrob Agents Chemother 57: 4769-4781, 2013. PubMed: 23877676

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation