Penicillium venetum (Frisvad) Frisvad (ATCC® 16025)

Strain Designations: IMI 19759 [CBS 201.57, QM 8403]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Penicillium cyclopium Westling
Strain Designations IMI 19759 [CBS 201.57, QM 8403]
Application
Fungus resistance testing electronic equipment
Media testing
Reference strain for performance testing culture media listed by the ISO TC 34 SC 9 Joint Working Group 5 in the ISO 11133 and by the Working Party on Culture Media of the International Committee on Food Microbiology and Hygiene (ICFMH-WPCM)
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments The strain was re-identified as Penicillium venetum based on the DNA sequence analyses
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence. GenBank accession number: KC146355

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTCACTGGCCGCCGGGGGGCTCACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGAAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGCCCCGTCCTCCGATTCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


Large subunit ribosomal RNA gene, partial sequence. GenBank accession number: KC146370

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGAGCGGTCCCCATCTAAGTGCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGTCGGTCAAAGGCCCTCGGAAGGTAACGCCCCTAGGGGCGTCTTATAGCCGAGGGTGCAATGCGACCTGCCTAGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAGCGA


beta-tubulin gene

TATCCCCTCCAGACGCGTCTTTTGTTTTCACACGGCCCCTGAGCCATGACCCCACTCTCAACAGATCTTTTGCTAACATGATCTAGGTTCACCTCCAAACCGGCCAGTGTGTAAGTTCGATATGGAATATTCTTGGAAACATTCTTCGATTCGTGGGACTAAATTGGAATTGGCTTGCAGGGTAACCAAATTGGTGCCGCTTTCTGGTAAGTGCCGAGCTTTTTTTTTTTCGCGTTGGGTATCAATTGACAGGTTACTAACTGGATTACAGGCAAACCATCTCTGGCGAGCACGGCCTCGATGGTGATGGACAGTAAGTTTTAATGGTGATGAGGGTTTCCGGTGGATCACACGTCTGATATCTTGCTAGGTACAATGGTACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACCATGTGAGTCCAACGACTGGAAAACGAATAATCGTGCATCATCTGATCGGATGTTTTCTTTGATAATCTAGGCCAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTCGTCGATTTGGAGCCCGGTACCATGGATGCTGTCCGCTCCGGTCCCTTCGGCAAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGTAACAACTGG

Name of Depositor IMI
Chain of Custody
ATCC <-- IMI <-- AS Boughey
Isolation
Hyacinthus sp. bulb, England
Cross References

Nucleotide (GenBank) : KC146355 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KC146370 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : AF003241 Penicillium hirsutum var. venetum beta-tubulin gene, partial

References

. . British military specifications : .

Microbiology of food and animal feeding stuffs--Guidelines on preparation and production of culture media-- Part 2: Practical guidelines on performance testing of culture media.. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 11133-2:2003.

Microbiology of food and animal feeding stuffs --- Guidelines on preparation and production of culture media --- Part 2: Practical guidelines on performance testing of culture media - Annex B: Recommended test microorganisms for commonly used culture media. London, UK:British Standards Institution;British Standard DD CEN ISO/TS 11133:2003.

ISO/CD 11133:2009, Annex E. Test microorganisms for commonly used culture media (giving information on the culture medium, culture conditions, test microorganisms, culture collection number of test organisms and the expected reactions)

Corry, JEL, Curtis, GDW and Baird, RM (Eds) Handbook of Culture Media for Food and Water Microbiology. Royal Society of Chemistry, In preparation. ICFMH-WPCM.

Seifert KA, Louis-Seize G. Phylogeny and species concepts in the Penicillium aurantiogriseum complex as inferred from partial beta-tubulin gene DNA sequences. In: Integration of modern taxonomic methods for Penicillium and Aspergillus classification (Samson RA, Pitt JI, eds.), pp. 189-198, Taylor and Francis Books Ltd., UK, 2000.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation