Sporidiobolus salmonicolor Fell et Tallman, teleomorph (ATCC® MYA-4550)

Alternate State: Sporobolomyces salmonicolor (Fischer et Brebeck) Kluyver et van Niel, anamorph  /  Strain Designations: VITEK 301525 [MUCL 51628]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Sporobolomyces salmonicolor
Strain Designations VITEK 301525 [MUCL 51628]
Alternate State Sporobolomyces salmonicolor (Fischer et Brebeck) Kluyver et van Niel, anamorph
Application
quality control strain
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Quality control strain for VITEK2 Yeast Identification Card (listed as Sporobolomyces salmonicolor).
Sequenced Data
LSU rDNA of MYA-4550

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAAAGCTCAAATTTGTAATCTGGCGCTTTCGGCGTCCGAGTTGTAATCTCGAGAAGTGTTTTCCGCGTCAGACCGCACACAAGTCTCCTGGAACGGAGCGTCACAGTGGTGAGAACCCAGTACACGGTGCGGATGCCTGATGCTTTGTGATACACTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTATTCGGAGCTTGCTTCGATTCGCAGGCCCGCATCAGTTTTCCGGGGCGGAAAATCGTAAGGAGAAGGTAGCAGTTTCGGCTGTGTTATAGCTCTTTACTGGATTCGTCCTGGGGGACTGAGGAACGCAGCGTGCTTTTTGCATGGGCTTCGGCCCATCCACGCTTAGGATGCGGGTGGAATGGCTTTAAACGAC


ITS of MYA-4550

TTTCCGTAGGTGAACCTGCGGAAGGATCATTAGTGAATAAACAGGGTGTCCAATTTAACTTGGAGCCCAACCTTCTCACTTTCTAACCCTGTGCATCTGTATCTAACGGTGAGCTGCCTTCGGGTGGCGAGCCTTCACTTTAAAACACCAAGTCTATGAATGTATATAATCATAACTATATAAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATCTTGCACTCTCTGGTATTCCGGAGAGTATGTCTGTTGGAGTGTCATGAATTCTTCAACCCCACCGTTTCTTGCAAACGCGTGGGTGCTTGGATTCTGAGCGCTGCTGGCTTCGGCCTAGCTCGTTCGTAATGCATTAGCATCCCGATGACAAGTTTGGATTGACTTGGCGTAATAGACTATTCGCTGAGGAGTAAGTGGCCTTCGGGTTACTGAGCCAACTCGTTTCAGGAAGCTTCTAATCCCTAAAGTCTACCTTTTAGATTAGATCTCCAATCAGGCAGGATTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGA

Name of Depositor bioMerieux, Inc.
Special Collection ATCC
Chain of Custody
ATCC <-- bioMerieux, Inc.
Cross References

Nucleotide (GenBank) : FJ914903 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ914884 ITS including 5.8S rRNA gene

References

VITEK 2 YST Comprehensive QC Set. bioMerieux.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation