Aureobasidium pullulans (de Bary) Arnaud (ATCC® 9348)

Strain Designations: F-44 [CBS 621.80, DSM 2404, IMI 145194, QM 3090]  /  Product Format: freeze-dried

Deposited As Pullularia pullulans (de Bary) Berkhout
Strain Designations F-44 [CBS 621.80, DSM 2404, IMI 145194, QM 3090]
Application
Bacterial resistance testing adhesives
Degrades plastics
Fungus resistance testing
Fungus resistance testing adhesives
Fungus resistance testing lacquer
Fungus resistance testing paint
Fungus resistance testing plastics
Fungus resistance testing textiles
Fungus resistance testing varnish
Produces inulosucrase fructosyl transferase
Produces pullulan
Testing
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments The DNA barcode sequences indicate that this fungus is close to Aureobasidium pullulans var. melanogenum (= A. melanigenum).
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAGTAAGGGTGCTCAGCGCCCGACCTCCAACCCTTTGTTGTTAAAACTACCTTGTTGCTTTGGCGGGACCGCTCGGTCTCGAGCCGCTGGGGATTCGTCCCAGGCGAGCGCCCGCCAGAGTTAAACCAAACTCTTGTTATTTAACCGGTCGTCTGAGTTAAAATTTTGAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCTTGGTATTCCGAGGGGCATGCCTGTTCGAGCGTCATTACACCACTCAAGCTATGCTTGGTATTGGGTGCCGTCCTTAGTTGGGCGCGCCTTAAAGACCTCGGCGAGGCCTCACCGGCTTTAGGCGTAGTAGAATTTATTCGAACGTCTGTCAAAGGAGAGGACTTCTGCCGACTGAAACCTTTATTTTTCTAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAAGCTGGCCTTCGGGTCCGCATTGTAATTTGTAGAGGATGCTTTGGGTGAAACGCCAGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTATGTGACTGGAAATGTTAACCTATGTAAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCGAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAATCAGACTTGTTTAAACTGTTCGGCCGGTCTTCTGACCGGTTTACTCAGTTTGGACAGGCCAGCATCAGTTTCGGCGGCCGGATAAAGGCTCTGGGAATGTGGCCTTCACTTCGGTGAAGGTGTTATAGCCCAGGGTGTAATACGGCCAGCCGGGACTGAGGTCCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC

Name of Depositor PB Marsh
Chain of Custody
ATCC <-- PB Marsh <-- WL White F-44 <-- GF Weber
Isolation
Deteriorated army supplies, Florida
Cross References

Nucleotide (GenBank) : KU933441 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU933415 D1/D2 region of 28S rRNA gene

References

Catley BJ. The extracellular polysaccharide, pullulan, produced by Aureobasidium pullulans: a relationship between elaboration rate and morphology. J. Gen. Microbiol. 120: 265-268, 1980.

Heady RE. Process for the production of high fructose syrups and ethanol. US Patent 4,356,262 dated Oct 26 1982

Heady RE. Preparation of high fructose syrups from sucrose. US Patent 4,276,379 dated Jun 30 1981

Bock A, et al. Aureobasidium pullulans strain, process for its preparation, and use thereof. US Patent 5,019,514 dated May 28 1991

ASTM International Standard Test Method for Resistance to Growth of Mold on the Surface of Interior Coatings in an Environmental Chamber. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 3273-00 (Reapproved 2005).

ASTM International Standard Test Methods for Ability of Adhesive Films to Support or Resist the Growth of Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4300-01.

ASTM International Standard Test Methods for Resistance of Adhesive Preparations in Container to Attack by Bacteria, Yeast, and Fungi. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 4783-01e1.

Deutsches Institut fur Normung Testing of plastics: Influence of fungi and bacteria; visual evaluation, change in mass or physical properties. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 53739.

IEC Basic environmental testing procedures: Mould growth. Geneva (Switzerland):International Electrotechnical Commission;IEC 60068-2-10, Part 2, Test J.

Klausmeier RE. Results of the second interlaboratory experiment of biodeterioration of plastics. Int. Biodeterior. Bull. 8: 3-7, 1972.

Catley BJ, Hutchinson A. Elaboration of pullulan by spheroplasts of Aureobasidium pullulans. Trans. Br. Mycol. Soc. 76: 451-456, 1981.

West TP, Reed-Hamer B. Effect of Ph on pullulan production relative to carbon source and yeast extract composition of growth medium. Microbios 75: 75-82, 1993.

Environmental testing. Part 2.10: Tests--Test J and guidance: Mould growth. Sydney, NSW, Australia:Standards Australia;Standards Australia AS 60068.2.10-2003.

Fibre Optic interconnecting divices and passive components --Basic test and measurement procedures--Part 2-16: Tests --Mould growth. Geneva (Switzerland):International Electrotechnical Commission;IEC 1300-2-16, 1995

Plastics--Evaluation of the action of micro-organisms. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 846:1997.

Testing of textiles -- Evaluation of the action of microfungi. London, UK:British Standards Institution;British Standard BS EN 14119:2003, 2003

Standard method of evaluating the resistance of wood product surfaces to mold growth. Birmingham, AL: American Wood-Preservers' Association; AWPA E24-06, 2006

Plastics - Evaluation of the action of microorganisms. London, UK:British Standards Institution;British Standard BS EN ISO 846:1997.

Loncaric I, et al. Phenotypic and genotypic diversity among strains of Aureobasidium pullulans in comparison with related species. Antonie van Leeuwenhoek 95: 165-178, 2009. PubMed: 19123008

Zalar P, et al. Redefinition of Aureobasidium pullulans and its varieties. Stud Mycol 61: 21-38, 2008. PubMed: 19287524