Penicillium ludwigii Udagawa (ATCC® 9112)

Strain Designations: USDA 1336.2 [ATCC 9824, CBS 110.66, IMI 61271, NRRL 744, QM 477, VKM F-1827]  /  Product Format: freeze-dried

Deposited As Penicillium sp.
Strain Designations USDA 1336.2 [ATCC 9824, CBS 110.66, IMI 61271, NRRL 744, QM 477, VKM F-1827]
Application
Fungus resistance testing
Fungus resistance testing aircraft transmissions
Fungus resistance testing plastics
Fungus resistance testing textiles
Produces glucan endo-1,6-beta-glucosidase beta-D-1,6 glucanase
Produces purine beta-ribonucleosidases
Resistant to copper
Testing
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments The strain was re-identified as Penicillium ludwigii, a close sister of P. ochro-chloron and P. janthinellum, based on the multigene sequence analysis. This change does not affect to its use as quality control strain for standard tests.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCATACCTAGTTGCTTCGGCGGGCCCGCCGTCATGGCCGCCGGGGGGCACCCGCCCCCGGGCCCGCGCCCGCCGAAGCCCCCCTGAACGCTGTCTGAAGATTGCAGTCTGAGCGATTAGCTAAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCCGCCCCCCGGCTCCCGGGGGGCGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGTAGGCCCGGCCGGCGCCCGCCGGCGACCCCCCTCAATCTTTCTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCCCCTTCGGGGTCCGCATTGTAATTTGCAGAGGATGCTTCGGGAGCGGCCCCCATCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGATGGGGTGCCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGGGGTTCAGCCGGCCTTCGGGCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCCTCGGAATGTAACGCCCCCCGGGGCGTCTTATAGCCGAGGGTGCCATGCGGCCAGCCCGGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAGCGAC


beta-tubulin (TUB2) gene

CCCACCCCGATTCGACGCGTCCTGTGTTTTCCCATTACCCCTGAAGTCAACAACCCCCACCTGTTCAGCCTGTGCTAACCTCCCTCTTTTCGACGACTTTATAGGTCCACCTCCAGACCGGCCAGTGTGTAAGTGACGTCCAGCAACACGTGGAAGAAGTGTCTATGTGAGGAATGTGATGGTTCGACTAAACGGAATTTGGGTGTTTATAGGGTAACCAAATCGGTGCCGCTTTCTGGTACGTGTCACGCCCGCCAAAAACTCCCTCAGCACAACAAACCATCCCTCAATTGCGACTTTTGGATGGGGAAAATTATACTGACTCGAATTACAGGCAGACCATTGCTGGTGAGCATGGCCTTGACGGCGATGGCCAGTAAGTTCCATCGATACGCTCTCGATACCCCTCGACGCGGAATGGCGGTCTGATATTTTTGGCTAGCTACAACGGTACCTCCGACCTCCAGCTCGAACGCCTGAACGTCTACTTCACCCACGTGAGTTGCGTGCCCAGCCAACGACAAACCCCAAAAGCAATTCTAACTATGAATATTTGGTATATTAGGCCAGCGGTGACAAGTATGTTCCTCGTGCCGTTCTGGTCGATCTGGAGCCCGGTACCATGGACGCTGTCCGTGCCGGTCCCTTTGGCAAGCTCTTCCGTCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCCGGTAACAACTGG

Name of Depositor GA Greathouse
Chain of Custody ATCC <-- GA Greathouse
Cross References

Nucleotide (GenBank) : KU933447 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU933423 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KU897011 beta-tubulin (TUB2) gene

References

Deutsches Institut fur Normung Testing of plastics: Influence of fungi and bacteria; visual evaluation, change in mass or physical properties. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 53739.

Environmental testing. Part 2.10: Tests--Test J and guidance: Mould growth. Sydney, NSW, Australia:Standards Australia;Standards Australia AS 60068.2.10-2003.

Fibre Optic interconnecting divices and passive components --Basic test and measurement procedures--Part 2-16: Tests --Mould growth. Geneva (Switzerland):International Electrotechnical Commission;IEC 1300-2-16, 1995

IEC Basic environmental testing procedures: Mould growth. Geneva (Switzerland):International Electrotechnical Commission;IEC 60068-2-10, Part 2, Test J.

Reese ET. Extracellular purine beta-ribosidases from fungi. Can. J. Microbiol. 14: 377-383, 1968. PubMed: 5646838

Reese ET, Mandels M. beta-Glucanases other than cellulase. Methods Enzymol. 8: 607-615, 1966.

Plastics--Assessment of the effectiveness of fungistatic compounds in plastics formulations. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 16869:2001.

Plastics--Evaluation of the action of micro-organisms. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 846:1997.

Plastics - Evaluation of the action of microorganisms. London, UK:British Standards Institution;British Standard BS EN ISO 846:1997.

Testing of textiles -- Evaluation of the action of microfungi. London, UK:British Standards Institution;British Standard BS EN 14119:2003, 2003

U.S. Department of Defense Environmental test methods and engineering guidelines. Washington, DC:US Department of Defense;Military Standard MIL-STD-810F, 2000