Candida lusitaniae van Uden et do Carmo Sousa (ATCC® 66035)

Alternate State: Clavispora lusitaniae Rodrigues de Miranda, teleomorph  /  Strain Designations: AmMS 233  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations AmMS 233
Alternate State Clavispora lusitaniae Rodrigues de Miranda, teleomorph
Application
quality control strain for MicroScan [Reg TM] products
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

CTGCGGAAGGATCATTAAAAAATACATTACACATTGTTTTTGCGAACAAAAAAATAAATTTTTTTATTCGAATTTCTTAATATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAGTATGACTTGCAGACGTGAATCATCGAATCTTTGAACGCACATTGCGCCTCGAGGCATTCCTCGAGGCATGCCTGTTTGAGCGTCGCATCCCCTCTAACCCCCGGTTAGGCGTTGCTCCGAAATATCAACCGCGCTGTCAAACACGTTTACAGCACGACATTTCGCCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA

Name of Depositor GJ De Leon
Cross References

Nucleotide (GenBank) : AX109691 Sequence 424 from Patent WO0123604.

Nucleotide (GenBank) : AX109737 Sequence 470 from Patent WO0123604.

Nucleotide (GenBank) : AX110835 Sequence 1568 from Patent WO0123604.

References

MicroScan Yeast ID QC Set. Dade/Siemens.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation