Rhodotorula mucilaginosa (Jorgensen) Harrison var. mucilaginosa (ATCC® 66034)

Strain Designations: AmMS 232  /  Product Format: freeze-dried

Deposited As Rhodotorula rubra (Demme) Lodder
Strain Designations AmMS 232
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Morphology After 4 days on Emmons’ modification of Sabouraud’s agar at 25°C, colonies are pink, smooth, glossy. Cells are subglobose or ovoidal, single or in pairs, pseudohyphae are absent.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TCATTAGTGAATATAGGACGTCCAACTTAACTTGGAGTCCGAACTCTCACTTTCTAACCCTGTGCACTTGTTTGGGATAGTAACTCTCGCAAGAGAGCGAACTCCTATTCACTTATAAACACAAAGTCTATGAATGTATTAAATTTTATAACAAAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCATGGTATTCCGTGGAGCATGCCTGTTTGAGTGTCATGAATACTTCAACCCTCCTCTTTCTTAATGATTGAAGAGGTGTTTGGTTTCTGAGCGCTGCTGGCCTTTACGGTCTAGCTCGTTCGTAATGCATTAGCATCCGCAATCGAACTTCGGATTGACTTGGCGTAATAGACTATTCGCTGAGGAATTCTAGTCTTCGGACTAGAGCCGGGTTGGGTTAAAGGAAGCTTCTAATCAGAATGTCTACATTTTAAGATTAGATCTCAAATCAGGTAGGACTAC


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAGCGGCGAGCGAAGCGGGAAGAGCTCAAATTTATAATCTGGCACCTTCGGTGTCCGAGTTGTAATCTCTAGAAATGTTTTCCGCGTTGGACCGCACACAAGTCTGTTGGAATACAGCGGCATAGTGGTGAGACCCCCGTATATGGTGCGGACGCCCAGCGCTTTGTGATACATTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAATTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAACAGTACGTGAAATTGTTGGAAGGGAAACGCTTGAAGTCAGACTTGCTTGCCGAGCAATCGGTTTGCAGGCCAGCATCAGTTTTCCGGGATGGATAATGGTAGAGAGAAGGTAGCAGTTTCGGCTGTGTTATAGCTCTCTGCTGGATACATCTTGGGGGACTGAGGAACGCAGTGTGCCTTTGGCGGGGGTTTCGACCTCTTCACACTTAGGATGCTGGTGGAATGGCTTTAAACGAC

Morphology After 4 days on Emmons’ modification of Sabouraud’s agar at 25°C, colonies are pink, smooth, glossy. Cells are subglobose or ovoidal, single or in pairs, pseudohyphae are absent.
Name of Depositor GJ De Leon
Cross References

Nucleotide (GenBank) : EU853846 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729186 D1/D2 region of 28S rRNA gene

References

MicroScan Yeast ID QC Set. Dade/Siemens.