Cryptococcus uniguttulatus (Wolfram et Zach) Phaff et Fell (ATCC® 66033)

Alternate State: Filobasidium uniguttulatum Kwon-Chung, teleomorph  /  Strain Designations: AmMS 234  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations AmMS 234
Alternate State Filobasidium uniguttulatum Kwon-Chung, teleomorph
Application
quality control strain
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology On Emmons’ modification of Sabouraud’s medium at 25°C after 6 days, colonies dingy white to buff, smooth, raised, butyrous to mucoid, margin entire. Cells subglobose to ellipsoidal, smooth, hyaline, 3-5 X 2.5-4.5 µm. Pseudohyphae not observed.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTATTGAATTTAGTTGTCTGGCTTTCGCCGACGACGATATCATTATCCATAACACCTGTGCACTGTTGGATGTTTAATACATCCGTTTTACACTAAACAATATTGTTACAAATGTAGTCTTATTATAACATAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGAAACTCTCAAACTCTTGTTTTGGATGCAAATCCTTGCTTGAGTTTGGACTTGGGTGTTTGCCGGTGATGAACCGACTCGCCTTAAACATATTAGCTGGACTTGTCTATATGACTGGTTTGACTTGGCATAATAAGTATTTTGCTAAGGACATCTTCGGATGGCCAGTACCTAGGCTCTGTGTCTGCTAACTAAACCATCACTTGGAGTGCATCTTTATGGTGTTGCTTCCTGTGTATACTTTGACATCTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGCGAAGCGGGAAGAGCTCAAATTTGAAATCTGGTGGCCTCAGGTCATCCGAGTTGTAATCTATAGAAGTGTTTTCCGTGCTGGCCCATGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACATGGACTACCAGTGCTCTGTGATACACTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTATGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGCTCAATGGACTCAGCCGTTCTGCGGTGTATTTCCATTGGGTGGGGTCAACATCAGTTTTGATCGCTGGATAAAGGCAGGAGGAATGTAGCACCCCCGGGTGAACTTATAGCCTCTTGTCACATACAGTGGTTGGGACTGAGGAACGCAGCATGCCTTTATGGCCGGGATTCGTCCACGTACATGCTTAGGATGTTGACATAATGGCTTTAAACGA

Morphology On Emmons’ modification of Sabouraud’s medium at 25°C after 6 days, colonies dingy white to buff, smooth, raised, butyrous to mucoid, margin entire. Cells subglobose to ellipsoidal, smooth, hyaline, 3-5 X 2.5-4.5 µm. Pseudohyphae not observed.
Name of Depositor GJ De Leon
References

MicroScan Yeast ID QC Set. Dade/Siemens.

McTaggart LR, et al. Rapid identification of Cryptococcus neoformans and Cryptococcus gattii by matrix-assisted laser desorption ionization-time of flight mass spectrometry. J. Clin. Microbiol. 49: 3050-3053, 2011. PubMed: 21653762

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation