Candida glabrata (Anderson) Meyer et Yarrow (ATCC® 64677)

Strain Designations: LRA 85.10.75  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Candida glabrata (Anderson) Meyer et Yarrow, anamorph
Strain Designations LRA 85.10.75
Application
quality control strain
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 4 days on YM agar at 25°C colonies cream color, smooth, dull butyous and entire margins. Cells subglobose to ovoid and occur singly or in pairs.
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GTTTCCGTAGGTGAACCTGCGGAAGGATCATTAAAGAAATTTAATTGATTTGTCTGAGCTCGGAGAGAGACATCTCTGGGGAGGACCAGTGTAGACACTCAGGAGGCTCCTAAAATATTTTCTCTGCTGTGAATGCTATTTCTCCTGCCTGCGCTTAAGTGCGCGGTTGGTGGGTGTTCTGCAGTGGGGGGAGGGAGCCGACAAAGACCTGGGAGTGTGCGTGGATCTCTCTATTCCAAAGGAGGTGTTTTATCACACGACTCGACACTTTCTAATTACTACACACAGTGGAGTTTACTTTACTACTATTCTTTTGTTCGTTGGGGGAACGCTCTCTTTCGGGGGGGAGTTCTCCCAGTGGATGCAAACACAAACAAATATTTTTTTAAACTAATTCAGTCAACACAAGATTTCTTTTAGTAGAAAACAACTTCAAAACTTTCAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACACGTTGTGTTTGGTAGTGAGTGATACTCTCGTTTTTGAGTTAACTTGAAATTGTAGGCCATATCAGTATGTGGGACACGAGCGCAAGCTTCTCTATTAATCTGCTGCTCGTTTGCGCGAGCGGCGGGGGTTAATACTGTATTAGGTTTTACCAACTCGGTGTTGATCTAGGGAGGGATATGTGAGTGTTCTGTGCGTGCTGGGCAGACAGACGTCTTTAAGTTTGACCTCAAATCAGGTAGGGTTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTGGTGCCCGAGTTGTAATTTGGAGAGTACCACTTTGGGACTGTACTTTGCCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTGTGGCGAGGGTGTCAGTTCTTTGTAAAGGGTGCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCTTGCCTCTCGTGGGCTTGGGACTCTCGCAGCTCACTGGGCCAGCATCGGTTTTGGCGGCCGGAAAAAACCTAGGGAATGTGGCTCTGCGCCTCGGTGTAGAGTGTTATAGCCCTGGGGAATACGGCCAGCCGGGACCGAGGACTGCGATACTTGTTATCTAGGATGCTGGCATAATGGTTATATGCCGC

Morphology After 4 days on YM agar at 25°C colonies cream color, smooth, dull butyous and entire margins. Cells subglobose to ovoid and occur singly or in pairs.
Name of Depositor API System/bioMerieux
References

API ID 32 C. bioMerieux.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation