Tyromyces palustris (Berkeley et Curtis) Murrill (ATCC® 62978)

Strain Designations: FES 0507 [IFO 30339]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations FES 0507 [IFO 30339]
Application
testing wood preservatives
testing wood for natural resistance to decay
Biosafety Level 1
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology Growth moderately rapid. After 2 weeks at 25°C colony of downy mycelium, mat white, slightly raised, cottony and floccose, becoming thin and felty.  Abundant clamp connections observed.
Medium ATCC® Medium 323: Malt agar medium
Growth Conditions
Temperature: 24°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAATGAATTTTGAAAGGGGTTGTAGCTGGCCGTCTCTTTGGGGCGGCATGTGCACGCCCTGATCACTATCCATCTCACACACCTGTGCACACACTGTAGGTTGGCTTGTGATTGGAGCTTACAGTCTTCATTGACTTTGCTCTGGTTGGAGGCCCTCCTATGTATTATCACAAACTACTTCAGTTTAAAGAATGTACTCTTGCGTCTAACGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCTATTTGCTTTTGTGAATAGAGCTTGGATTTGGAGGTTTATTGCTGGTACTTGTGATCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTATCGGTGTGATAATTGTCTACGCCGTTGCAGTGAAGCATATCAATGGGCTCGGCTTCCAATCGTCCTTTACTGGACAATGACTTTGACCTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGCTTTTCGCTTGGTGCATTTTCTGGTTGACGGGCCAGCATCGATTTTGACCACTGGAAAAAGGCTAGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTTAGTCACATACAGTGGTTGGGATCGAGGACCGCAGCACGCCTTTATGGCCGGGGTTCGCCCACGTTCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGAC

Morphology Growth moderately rapid. After 2 weeks at 25°C colony of downy mycelium, mat white, slightly raised, cottony and floccose, becoming thin and felty.  Abundant clamp connections observed.
Name of Depositor Y Abe
Chain of Custody
ATCC <-- Y Abe <-- K Kitajima
Isolation
Wooden electric pole, Japan
References

Test methods for determining the effectiveness of wood preservatives and their performance requirements. Tokyo, Japan:Japanese Standards Association;JIS K 1571, 2004

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation