Hanseniaspora valbyensis Klöcker (ATCC® 58370)

Strain Designations: NRRL Y-1382 [CBS 281]  /  Product Format: freeze-dried

Deposited As Kloeckera japonica Saito et Ohtani
Strain Designations NRRL Y-1382 [CBS 281]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes (type strain of Kloeckera japonica)
Preceptrol® no
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GCGGAAGGATCATTAGATTGAATTATCATTTTGTTGCTCGAGTTCTTTTAAGATCTTTTACAATTTAAATGGGTTGTCTTTGTTTGAGATGTGCGCTTAATTGCGCTGCTTATTCAGAGGCTCTCAGTAGAAGTAATTTTTAATTGAATCTCAGTCAACTACTACACACAGTGGAGTTTTCTACTTAATTCTTTCTACTTTGGGTCGCAAGATCCAAGGTAAAAACAAACACAAACAATTTTTTTTATTATAATTTTTTAAGCTAAACCAAAATTCCTAACGGAAATTTTAAATAATTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGTAGCGAATTGCGATAAGTAATGTGAATTGCAGATACTCGTGAATCATTGAATTTTTGAACGCACATTGCGTCCTCAGGTATTCCTGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAAAGAATATTTTATTATTTTTTTGGTAGTGAGCGATACTCAGGGTTAGCTTGAAATTGAAGATTTTTGTAATCTTTAATAATTCAACACTTAGCTTCTTTGGAGACGCTGTTCTCGCTGTGATGTATTTATGGATTCGTCTATTTTTTACATTTGCAAGGGATTCGGTAAAGTACCTTAGGCAAAGAGTTGTTTTTAATACTCATCAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAATA


D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTACCTTAGTAACGGCGAGTGAAGCGGTAAAAGCTCAAATTTGAAATCTGGTACTTTCAGTGCCCGAGTTGTAATTTGTAGAATTTGTTTTTGATTTGGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTTTGGCGAGGATACCATTTCTCTGTAAAACTTTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTTTGCATGCACTCGCCTCTCGTGGGCTTGGGCCTCTCAAAAATTTCACTGGGCCAACATCAGTTTTGGCGGTAGGATAAATCATTAGGAACGTAGCTTCTTCGGGAGTATTATAGCCTAGTGGAATACTATCAGCCGGGACTGAGGACTGCGCTTTATGCAAGGATGTTGGCATAATGGTTAAATGCCG

Name of Depositor NRRL
Isolation
Tree exudate; Japan
References

Saito K. On some fermentative yeasts isolated from sap exuded from tree trunks. J. Ferment. Technol. 9: 6-11, 1931.

VITEK 2 YST Comprehensive QC Set. bioMerieux.

type strain of Kloeckera japonica