Scopulariopsis brevicaulis (Saccardo) Bainier (ATCC® 36840)

Strain Designations: IMI 49528 [A. 1395, LSHB Sc76]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations IMI 49528 [A. 1395, LSHB Sc76]
Application
Fungus resistance testing
Fungus resistance testing textiles
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AGGGATCATTACCGAAGTTACTCTTCAAAACCCATTGTGAACCTTACCTCTTGCCGCGCGTTGCCTCGGCGGGGAGGCGGGGTCTGGGTCGGCGCGCCCCTCACCGGGCCGCCGTCCCCGTCCCCGTCCCCGCCGGCCGCGCCAAACTCTAAATTTGAAAAAGCGTACTGCACGTTCTGATTCAAAACAAAAAACAAGTCAAAACTTTTAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGGCAGCAATCTGCCGGGCATGCCTGTCCGAGCGTCATTTCTTCCCTCGAGCGCGGCTAGCCCTACGGGGCCTGCCGTCGCCCGGTGTTGGGGCTCTACGGGTGGGGCTCGTCCCCCCCGCAGTCCCCGAAATGTAGTGGCGGTCCAGCCGCGGCGCCCCCTGCGTAGTAGATCCTACATCTCGCATCGGGTCCCGGCGAAGGCCAGCCGTCGAACCTTTTATTTCATGGT


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGTCCCCTTTGGGGGCCCGAGTTGTAATTTGAAGAGGATGCTTTTGGCGAGGCGCCGTCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTACGGTCGGACGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTAAACCCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTAAAAGGGAAGCGCTTGCGACCAGACTTGCGCCCGTCGGATCAACCGTCGCTTGCGGCGGCGCACTCCGGCGGGCTCAGGCCAGCATCAGTTCGTCCGGGGGGAGAAAGGCGGCGGGAATGTGGCTCTTCGGAGTGTTATAGCCCGCCGTGTAATACCCTCGGGTGGACTGAGGACCGCGCGTATGCAAGGATGCTGGCGTAATGGTCGTCAGCGA

Name of Depositor IMI
Chain of Custody
ATCC <-- IMI <-- Herb. Bruxelles A. 1395
Isolation
Silkworm chrysalis
References

. . British specifications : .

Plastics--Evaluation of the action of micro-organisms. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 846:1997.

Testing of textiles -- Evaluation of the action of microfungi. London, UK:British Standards Institution;British Standard BS EN 14119:2003, 2003

Plastics - Evaluation of the action of microorganisms. London, UK:British Standards Institution;British Standard BS EN ISO 846:1997.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation