Talaromyces pinophilus (Hedgcock) Samson et al. (ATCC® 36839)

Strain Designations: IMI 114933 [CBS 631.66, CEB 3296.31, IAM 7013]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Penicillium funiculosum Thom
Strain Designations IMI 114933 [CBS 631.66, CEB 3296.31, IAM 7013]
Application
Fungus resistance testing
Fungus resistance testing plastics
Fungus resistance testing textiles
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGCGGGCCCTCGCGGCCCAACCTCCCACCCTTGTCTCTATACACCTGTTGCTTTGGCGGGCCCACCGGGGCCACCTGGTCGCCGGGGGACGCACGTCTCCGGGCCCGCGCCCGCCGAAGCGCTCTGTGAACCCTGATGAAGATGGGCTGTCTGAGTACTGTGAAAATTGTCAAAACTTTCAACAATGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCCCTGGCATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGTGTGGTCCCCCCGGGGACCTGCCCGAAAGGCAGCGGCGACGTCCGTCTGGTCCTCGAGCGTATGGGGCTCTGTCACTCGCTCGGGAAGGACCTGCGGGGGTTGGTCACCACCATGTTTTACCACGGTTGACCTCGGATCAGGTAGGAGTTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCCCTTTGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGTGCGGTCCCCGTCTAAGTGCCCTGGAACGGGCCGTCATAGAGGGTGAGAATCCCGTCTGGGATGGGCGGCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGTTGTCCACCAGACTCGCCCGGGGGGGTTCAGCCGGCACGTGTGCCGGTGTACTCCTCTCCGGGCGGGCCAGCATCGGTTTGGGCGGCTGGTGAAAGGCCCCGGGAATGTGCCACCCTTCGGGGTGCCTTATAGCCCGGGGTGCCATACAGCCAGCCTGGACCGAGGCCCGCGCTTCGGCGAGGATGCTGGCGTAATGGTGGTCAACGGC


beta-tubulin gene

CATTCTTTCCTCTGTCTCCCCCCTCTTTGACGCGTCTCGGGTATTCGTGTTTTGCACAACCCCCTGACCACCCCACTTTGTGTCTGCTCTGGTATGTGTGTTTTGAAATGCTACAATGTGCTAATCGACGCTTGTTTCTCGATATAGGTTCACCTCCAGACCGGCCAGTGCGTAAGTATTATCGATATCACCATGGAATGCTCGTTTTGTCGAAATAAATATTGAGATTGGGTGTGATAGGGTAACCAAATTGGTGCTGCTTTCTGGTGAGTTGGGCTCTCGACCTGGAATTTCTATCAATTGTCGTGACACCACGTTGACTTTTCCAGGCAAATCATCTCTGCTGAGCATGGCCTCGATGGCTCTGGTGTGTAAGTATTACACGATTCGAATGCAGCTACAATCCGACAAGATCTGATAATCAACAGCTACAATGGCTCCTCCGACCTCCAGTTGGAGCGTATGAACGTTTACTTCAACGAGGTGCGTCGAACCAATCCATTGTATAAGGGAACAAAGCTCATACTGGTGTAGGCCTCCGGCAACAAATACGTTCCCCGTGCCGTCCTCGTCGACTTGGAGCCCGGTACCATGGACGCCGTCCGCGCTGGTCCCTTTGGTCAGCTCTTCCGTCCCGACAACTTTGTTTTCGGTCAGTCCGGTGCTGGTAACAACTGG

Name of Depositor IMI
Chain of Custody
ATCC <-- IMI <-- CEB 3296.31
Isolation
Polyvinyl chloride plastic, France
References

Fujii T, et al. Taxonomic revision of the cellulose-degrading fungus Acremonium cellulolyticus nomen nudum to Talaromyces based on phylogenetic analysis. FEMS Microbiol Lett 351: 32-41, 2014. PubMed: 24313660

Samson RA, et al. Phylogeny and nomenclature of the genus Talaromyces and taxa accommodated in Penicillium subgenus Biverticillium. Stud Mycol 70: 159-183, 2011. PubMed: 22308048

Visagie CM, et al. Phylogenetic relationships and the newly discovered sexual state of Talaromyces flavovirens, comb. nov. Mycotaxon 122: 399-411, 2012.

Lopez-Villavicencio M, et al. Sex in Penicillium: combined phylogenetic and experimental approaches. Fungal Genet. Biol. 47: 693-706, 2010. PubMed: 20460164

Testing of textiles -- Evaluation of the action of microfungi. London, UK:British Standards Institution;British Standard BS EN 14119:2003, 2003

. The genus Penicillium. London: Academic Press; 1979.

Deutsches Institut fur Normung Testing of plastics: Influence of fungi and bacteria; visual evaluation, change in mass or physical properties. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 53739.

IEC Basic environmental testing procedures: Mould growth. Geneva (Switzerland):International Electrotechnical Commission;IEC 60068-2-10, Part 2, Test J.

U.S. Department of Defense Environmental test methods and engineering guidelines. Washington, DC:US Department of Defense;Military Standard MIL-STD-810F, 2000

Environmental testing. Part 2.10: Tests--Test J and guidance: Mould growth. Sydney, NSW, Australia:Standards Australia;Standards Australia AS 60068.2.10-2003.

Fibre Optic interconnecting divices and passive components --Basic test and measurement procedures--Part 2-16: Tests --Mould growth. Geneva (Switzerland):International Electrotechnical Commission;IEC 1300-2-16, 1995

Plastics--Evaluation of the action of micro-organisms. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 846:1997.

Plastics - Evaluation of the action of microorganisms. London, UK:British Standards Institution;British Standard BS EN ISO 846:1997.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation