Candida lusitaniae van Uden et do Carmo Sousa (ATCC® 34449)

Alternate State: Clavispora lusitaniae Rodrigues de Miranda, teleomorph  /  Strain Designations: IFO 1019 [CBS 4413, CCRC 20326, DBVPG 6142, IGC 2705, JCM 1814, NRRL Y-11826, NRRL Y-5394]  /  Product Format: freeze-dried

Strain Designations IFO 1019 [CBS 4413, CCRC 20326, DBVPG 6142, IGC 2705, JCM 1814, NRRL Y-11826, NRRL Y-5394]
Alternate State Clavispora lusitaniae Rodrigues de Miranda, teleomorph
Application
Degrades cellobiose
Produces ethyl alcohol ethanol
Quality control strain
Produces ethanol from cellobiose
Control strain for typing systems
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTGAACCTGCGGAAGGATCATTAAAAAATACATTACACATTGTTTTTGCGAACAAAAAAATAAATTTTTTTATTCGAATTTCTTAATATCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAATTGCGATACGTAGTATGACTTGCAGACGTGAATCATCGAATCTTTGAACGCACATTGCGCCTCGAGGCATTCCTCGAGGCATGCCTGTTTGAGCGTCGCATCCCCTCTAACCCCCGGTTAGGCGTTGCTCCGAAATATCAACCGCGCTGTCAAACACGTTTACAGCACGACATTTCGCCCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCCTGCGGGAATTGTAATTTGAAGGTTTCGTGGTCTGAGTCGGCCGCGCCCAAGTCCATTGGAACATGGCGCCTGGGAGGGTGAGAGCCCCGTATGGCGCACGCCGACTCTTTGCACCGCGGCTCCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGCTTGCAAGCAGACACGGTTTTACCGGGCCAGCGTCGAAAAGGGGGGAGGAACAAGAACTCGAGAATGTGGCGCGCACCTTCGGGCGCGCGTGTTATAGCTCGTGTTGACGCCTCCATCCCTTTTCGAGGCCTGCGATTCTAGGACGCTGGCGTAATGGTTGCAAGCCG

Name of Depositor IFO - Institute for Fermentation, Osaka
Chain of Custody
ATCC <--  IFO - Institute for Fermentation, Osaka <-- N. van Uden IGC 2705
Isolation Pig; Portugal
Cross References

Nucleotide (GenBank) : KU729100 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : AF218970 Clavispora lusitaniae strain ATCC 34449T 5.8S ribosomal RNA gene,

Nucleotide (GenBank) : AF009215 Candida lusitaniae ITS1, partial sequence, 5.8S ribosomal RNA gene,

References

Freer SN, Detroy RW. Characterization of cellobiose fermentations to ethanol by yeasts. Biotechnol. Bioeng. 25: 541-557, 1983.

Freer SN, Detroy RW. Direct fermentation of cellodextrins to ethanol by Candida wickerhamii and C. lusitaniae. Biotechnol. Lett. 4: 453-458, 1982.

van Uden N, Do Carmo-Sousa L. Further studies on the significance of temperature relations and vitamin deficiency patterns in yeast taxonomy. With descriptions of Candida parapsilosis var. querci nov. var., C. obtusa nov. comb. and C. lusitaniae nov. sp.. Port. Acta Biol. 6B: 239-256, 1959.

Vazquez JA, et al. Comparison of restriction enzyme analysis versus pulsed-field gradient gel electrophoresis as a typing system for Torulopsis glabrata and Candida species other than C. albicans. J Clin Microbiol 31: 2021-2030, 1993. PubMed: 8396585

VITEK 2 YST Comprehensive QC Set. bioMerieux.

Guzman B, Lachance MA, Herrera CM. Phylogenetic analysis of the angiosperm-floricolous insect-yeast association: Have yeast and angiosperm lineages co-diversified? Mol Phylogenet Evol 68: 161-175, 2013. PubMed: 23583418

Schoch CL, et al. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi. Proc Natl Acad Sci USA 109: 6241-6246, 2012. PubMed: 22454494

Lachance MA, et al. The D1/D2 domain of the large-subunit rDNA of the yeast species Clavispora lusitaniae is unusually polymorphic. FEMS Yeast Res 4: 253-258, 2003. PubMed: 14654429

Daniel HM, Meyer W. Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeasts. Int. J. Food Microbiol. 86: 61-78, 2003. PubMed: 12892922

Daniel HM, Sorrell TC, Meyer W. Partial sequence analysis of the actin gene and its potential for studying the phylogeny of Candida species and their teleomorphs. Int J Syst Evol Microbiol 51: 1593-1606, 2001. PubMed: 11491363

Chen YC, et al. Identification of medically important yeasts using PCR-based detection of DNA sequence polymorphisms in the internal transcribed spacer 2 region of the rRNA genes. J. Clin. Microbiol. 38: 2302-2310, 2000. PubMed: 10834993