Trichoderma viride Persoon : Fries (ATCC® 28020)

Strain Designations: T-67 [CBS 394.92, DAOM 145589]  /  Product Format: freeze-dried

Strain Designations T-67 [CBS 394.92, DAOM 145589]
Application
Fungus resistance testing textiles
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Physiology
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 323: Malt agar medium
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACCATACCAAACTGTTGCCTCGGCGGGGTCACGCCCCGGGTGCGTCGCAGCCCCGGAACCAGGCGCCCGCCGGAGGGACCAACCAAACTCTTTCTGTAGTCCCCTCGCGGACGTTATTTTTACAGCTCTGAGCAAAAATTCAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGACTTCGGGAACCCCTAAGACGGGATCCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCATGCGCAGTAGTTTGCACAACTCGCACCGGGAGCGCGGCGCGTCCACGTCCGTAAAACACCCAACTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTAGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGCGGCGGATCATCCGGGGTTCTCCCCGGTGCACTTCGCCGCGTTCAGGCCAGCATCAGTTCGGCGCGGGGGAAAAAGGCTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCATAATACCCTGTGCTGGACTGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGAC

Name of Depositor P LeClair
Chain of Custody
ATCC <-- P LeClair <-- R.M. Danielson
Isolation
Soil, Washington
Cross References

Nucleotide (GenBank) : AF011986 Trichoderma viride internal transcribed spacer 1, complete

Nucleotide (GenBank) : AJ222718 Trichoderma viride internal transcribed spacer 1 (ITS1), strain

References

Danielson RM, Davey CB. Non-nutritional factors affecting the growth of Trichoderma in culture. Soil Biol. Biochem. 5: 495-504, 1973.

Danielson RM, Davey CB. Carbon and nitrogen nutrition of Trichoderma. Soil Biol. Biochem. 5: 505-515, 1973.

Danielson RM, Davey CB. Effects of nutrients and acidity on phialospore germination of Trichodema in vitro. Soil Biol. Biochem. 5: 517-524, 1973.

AATCC Antifungal Activity, Assessment on Textile Materials: Mildew and Rot Resistance of Textile Materials. Research Triangle Park, NC:American Association of Textile Chemists and Colorists;AATCC Test Method 30-2004.

Ihrmark K, et al. Comparative molecular evolution of Trichoderma chitinases in response to mycoparasitic interactions. Evol Bioinform Online 6: 1-26, 2010. PubMed: 20454524

Samuels GJ. Trichoderma: systematics, the sexual state, and ecology. Phytopathology 96: 195-206, 2006. PubMed: 18943925

Lee C-F, Hseu T-H. Genetic relatedness of Trichoderma sect. Pachybasium species based on molecular approaches. Can J Microbiol 48: 831-840, 2002. PubMed: 12455615

Kullnig-Gradinger CM, Szakacs G, Kubicek CP. Phylogeny and evolution of the genus Trichoderma: a multigene approach. Mycol Res 106: 757-767, 2002.

Kindermann J, et al. Phylogeny of the genus Trichoderma based on sequence analysis of the internal transcribed spacer region 1 of the rDNA cluster. Fungal Genet Biol 24: 298-309, 1998. PubMed: 9756711