Penicillium chrysogenum Thom (ATCC® 10106)

Strain Designations: NRRL 807 [26, CBS 306.48, IMI 24314, LSHB Ad3 LSHB P19, QM 7500]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations NRRL 807 [26, CBS 306.48, IMI 24314, LSHB Ad3 LSHB P19, QM 7500]
Application
Produces chrysogenin
Quality control strain
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® yes
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTTACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGTAGAGGATGCTTCGGGAGCGGTCCCCATCTAAGTGCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATT


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGTAGAGGATGCTTCGGGAGCGGTCCCCATCTAAGTGCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGTCGGTCAAAGGCCCTCGGAAGGTAACGCCCCTAGGGGCGTCTTATAGCCGAGGGTGCAATGCGACCTGCCTAGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAACGAC


beta-tubulin gene

TCCCCTCCAGACGCGTCTTTTGTTTTCATATGGCCCCTGAGCCACGACCCCACTCCCAACAGATCTTTTGCTAACTTGCTCTAGGTTCACCTCCAAACCGGCCAGTGTGTAAGTTCGACATGGAACATTCTTGGAAACATTCTTCGATGCGTGGGACTAAACTGGAATTGGGTTATAGGGTAACCAAATTGGTGCCGCTTTCTGGTAAGTCTCGGAGTTTTTTTTTTCGCGTTGGGTATCAATTGACAAGTTGCTAACTGGATTACAGGCAAACCATCTCTGGCGAGCACGGTCTCGATGGCGATGGACAGTAAGTTTAACAGTGATGGGGATTCTGGTGGATCACACGTCTGATATCTTGCTAGGTACAATGGTACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGACTGGGAATCTTAATTGTGCATCATCTGATCGGGCGTTTTTCTTTGACAATCTAGGCCAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCCCGGTACCATGGACGCTGTCCGCTCCGGTCCCTTCGGCAAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGT

Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- C Thom 26
Isolation
Cheese, Connecticut
Cross References

Nucleotide (GenBank) : U57321 Penicillium chrysogenum class I chitin synthase (CHS1) gene,

Nucleotide (GenBank) : U57322 Penicillium chrysogenum class II chitin synthase (CHS2) gene,

Nucleotide (GenBank) : U57323 Penicillium chrysogenum class II chitin synthase (CHS3) gene,

Nucleotide (GenBank) : AF173559 Penicillium chrysogenum class III chitin synthase (CHS4) gene,

Nucleotide (GenBank) : AF241466 Penicillium chrysogenum small subunit ribosomal RNA gene, partial

Nucleotide (GenBank) : HQ026745 ITS including 5.8S rRNA gene

References

Clutterbuck PW, et al. Studies in the biochemistry of micro-organisms. The formation from glucose by members of the Penicillium chrysogenum series of a pigment, an alkali-soluble protein and penicillin -- the antibacterial substance of Fleming. Biochem. J. 26: 1907-1918, 1932.

Thom C. Cultural studies of species of Penicillium. U.S. Dep. Agric. Bur. Anim. Ind. 118: 1-109, 1910.

FF MicroPlate. Biolog.

Walker DM, et al. New molecular markers for fungal phylogenetics: two genes for species-level systematics in the Sordariomycetes (Ascomycota). Mol Phylogenet Evol 64: 500-512, 2012. PubMed: 22626621

Ropars J, et al. A taxonomic and ecological overview of cheese fungi. Int J Food Microbiol 155: 199-210, 2012. PubMed: 22381457

Houbraken J, et al. New penicillin-producing Penicillium species and an overview of section Chrysogena. Persoonia 29: 78-100, 2012. PubMed: 23606767

Houbraken J, Frisvad JC, Samson RA. Fleming's penicillin producing strain is not Penicillium chrysogenum but P. rubens. IMA Fungus 2: 87-95, 2011. PubMed: 22679592

Houbraken J, Samson RA. Phylogeny of Penicillium and the segregation of Trichocomaceae into three Families. Stud Mycol 70: 1-51, 2011. PubMed: 22308045

Peterson SW, Horn BW. Penicillium parvulum and Penicillium georgiense, sp. nov., isolated from the conidial heads of Aspergillus species. Mycologia 101: 71-83, 2009. PubMed: 19274850

An KD, et al. The identity of Penicillium sp. 1, a major contaminant of the stone chambers in the Takamatsuzuka and Kitora Tumuli in Japan, is Penicillium pineum. Antonie van Leeuwenhoek 96: 579-592, 2009. PubMed: 19784794

Wang L, Zhang XM, Zhuang WY. Penicillium macrosclerotiorum, a new species producing large sclerotia discovered in south China. Mycol Res 111: 1242-1248, 2007. PubMed: 17998158

Rakeman JL, et al. Multilocus DNA sequence comparisons rapidly identify pathogenic molds. J Clin Microbiol 43: 3324-3333, 2005. PubMed: 16000456

Wang L, et al. Penicillium persicinum, a new griseofulvin, chrysogine and roquefortine C producing species from Qinghai Province, China. Antonie van Leeuwenhoek 86: 173-179, 2004. PubMed: 15280651

Scott J, et al. Genotypic variation in Penicillium chysogenum from indoor environments. Mycologia 96: 1095-1105, 2004. PubMed: 21148929

Hong SG, et al. Sequence comparison of mitochondrial small subunit ribosomal DNA in Penicillium. J Microbiol 38: 62-65, 2000.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation