To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X

Fusarium verticillioides (Saccardo) Nirenberg (ATCC® MYA-3629)

Strain Designations: H66173  /  Product Format: frozen

Permits and Restrictions

View Permits

Classification Fungi, Dikarya, Ascomycota, Pezizomycotina, Sordariomycetes, Hypocreomycetidae, Hypocreales, Nectriaceae, Fusarium
Strain Designations H66173
Application
Antifungal susceptibility testing RefGhannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006. RefEspinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Human pathogen.
This organism is a CLSI control strain for antimicrobial susceptibility testing.
Morphology After 1 week at 25°C colonies very fast growing. Arial mycelium abundant, loosely pannose, white to buff, later vinaceous if discoloured by the substrate. Macroconidia rare, delicate, slender, falcate but rather straight, 3-5-septate, 31-58 × 2.7-3.6. Microconidia abundant, mostly 1-celled, ovoidal to clavate with a flattened base, in chains, 7-10 × 2.5-3.2 µm.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCAGCTTGGTGTTGGGACTCGCGAGTCAAATCGCGTTCCCCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCGGGCCCGAGTTGTAATTTGTAGAGGATACTTTTGATGCGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGATGCCAAATCTCTGTAAAGTTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGTTTATGACCAGACTTGGGCTTGGTTAATCATCTGGGGTTCTCCCCAGTGCACTTTTCCAGTCCAGGCCAGCATCAGTTTTCGCCGGGGGATAAAGACTTCGGGAATGTGGCTCTCTTCGGGGAGTGTTATAGCCCGTTGTGTAATACCCTGGCGGGGACTGAGGTTCGCGCATCTGCAAGGATGCTGGCGTAATGGTCATCAACGAC


Elongation factor 1-alpha gene

TTAGTCACTTTTCCTTCTATCGCGCGTTCTTTGCCCATCGATTCCCCCCTACGACTCGAAACGTACCCGCTACCCCGCTCGAGCCCAAAAATTTTGCGATACGACCGTAATTTTTTCTGGTGGGGCATTTACCCCGCCACTCGAGCGGCGCGTTTCTGCCCTCTCCCATTCCACAACCTCACTGAGCTCATCGTCACGTGTCAAGCAGTCACTAACCATCCGACAATAGGAAGCCGCTGAGCTC

Morphology After 1 week at 25°C colonies very fast growing. Arial mycelium abundant, loosely pannose, white to buff, later vinaceous if discoloured by the substrate. Macroconidia rare, delicate, slender, falcate but rather straight, 3-5-septate, 31-58 × 2.7-3.6. Microconidia abundant, mostly 1-celled, ovoidal to clavate with a flattened base, in chains, 7-10 × 2.5-3.2 µm.
Name of Depositor MG Rinaldi
Special Collection NSF - Mycology
Chain of Custody
ATCC <-- MG Rinaldi
Isolation
Patient, Milwaukee Wisconsin, United States
Geographical Isolation Wisconsin Children's Hospital
References

Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi: Approved Standard - 2nd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A2.

Espinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.

Ghannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation