To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X

Candida glabrata (Anderson) Meyer et Yarrow (ATCC® MYA-2950)

Genome Data Seal Click here to learn about our Enhanced Authentication Initiative

Strain Designations: 303542  /  Product Format: frozen

Verified By Whole-genome Sequencing
Classification Fungi, Ascomycota, Saccharomycotina, Saccharomycetes, Saccharomycetidae, Saccharomycetales, Candida
Strain Designations 303542
Application
Quality control strain
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology After 3 days at 25°C in YM broth, the cells are subglobose to ovoid, 2.5-4 x 3-6 μm, and occur singly or in pairs.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

TCATTAAAGAAATTTAATTGATTTGTCTGAGCTCGGAGAGAGACATCTCTGGGGAGGACCAGTGTAGACACTCAGGAGGCTCCTAAAATATTTTCTCTGCTGTGAATGCTATTCATCCTGCCTGCGCTTAAGTGCGCGGTTGGTGGGTGTTCTGCAGTGGGGGGAGGGAGCCGACAAAGACCTGGGAGTGTGCGTGGATCTCTCTATTCCAAAGGAGGTGTTTTATCACACGACTCGACACTTTCTAATTACTACACACAGTGGAGTTTACTTTACTACTATTCTTTTGTTCGTTGGGGGAACGCTCTCTTTCGGGGGGGGAGTTCTCCCAGTGGATGCAAACACAAACAAATATTTTTTTAAAATAATTCAGTCAACACAAGATTTCTTTTAGTAGAAAACAACTTCAAAACTTTCAACAATGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCGGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACACGTTGTGTTTGGTAGTGAGTGATACTCTCGTTTTTGAGTTAACTTGAAATTGTAGGCCATATCAGTATGTGGGACACGAGCGCAAGCTTCTCTATTAATCTGCTGCTCGTTTGCGCGAGCGGCGGGGGTTAATACTGTATTAGGTTTTACCAACTCGGTGTTGATCTAGGGAGGGATAAGTGAGTGTTTTGTGCGTGCTGGGCAGACAGACGTCTTTAAGTTTGACCTCAAATCAGGTAGGG


D1D2 region of the 26S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACTGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGTACCTTTGGTGCCCGAGTTGTAATTTGGAGAGTACCACTTTGGGACTGTACTTTGCCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTGTGGCGAGGGTGTCAGTTCTTTGTAAAGGGTGCTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATACAGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGCCCCTTGCCTCTCGTGGGCTTGGGACTCTCGCAGCTCACTGGGCCAGCATCGGTTTTGGCGGCCGGAAAAAACCTAGGGAATGTGGCTCTGCGCCTCGGTGTAGAGTGTTATAGCCCTGGGGAATACGGCCAGCCGGGACCGAGGACTGCGATACTTGTTATCTAGGATGCTGGCATAATGGTTATATGCCGC

Morphology After 3 days at 25°C in YM broth, the cells are subglobose to ovoid, 2.5-4 x 3-6 μm, and occur singly or in pairs.
Name of Depositor J Colon-Reveles
Special Collection NCRR Contract
Chain of Custody
ATCC <-- J Colon-Reveles
Cross References

Nucleotide (GenBank) : KU729056 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729136 D1/D2 region of 26S rRNA gene

References

VITEK 2 YST Comprehensive QC Set. bioMerieux.