Search

Fomitopsis palustris (Berkeley et Curtis) Gilbertson et Ryvarden (ATCC® 62978™)

Strain Designations: FES 0507 [IFO 30339]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Tyromyces palustris (Berkeley et Curtis) Murrill
Strain Designations FES 0507 [IFO 30339]
Application
Testing wood preservatives
Testing wood for natural resistance to decay
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Genome sequencing strain (National Institute of Forest Science, South Korea)
Morphology Growth moderately rapid. After 2 weeks at 25°C colony of downy mycelium, mat white, slightly raised, cottony and floccose, becoming thin and felty.  Abundant clamp connections observed.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTAATGAATTTTGAAAGGGGTTGTAGCTGGCCGTCTCTTTGGGGCGGCATGTGCACGCCCTGATCACTATCCATCTCACACACCTGTGCACACACTGTAGGTTGGCTTGTGATTGGAGCTTACAGTCTTCATTGACTTTGCTCTGGTTGGAGGCCCTCCTATGTATTATCACAAACTACTTCAGTTTAAAGAATGTACTCTTGCGTCTAACGCATTTAAATACAACTTTCAGCAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCATGGAATTCTCAACTCTATTTGCTTTTGTGAATAGAGCTTGGATTTGGAGGTTTATTGCTGGTACTTGTGATCGGCTCCTCTTGAATGCATTAGCTCGAACCTTTGCGGATCAGCTATCGGTGTGATAATTGTCTACGCCGTTGCAGTGAAGCATATCAATGGGCTCGGCTTCCAATCGTCCTTTACTGGACAATGACTTTGACCTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTTTGGCCGTCCGAGTTGTAGTCTGGAGAAGTGCTTTCCGCGCTGGACCGTGTACAAGTCTCTTGGAACAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAGTGCTTTGTGATGCGCTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTGGCCAGGACTCAGCCTTGCTTTTCGCTTGGTGCATTTTCTGGTTGACGGGCCAGCATCGATTTTGACCACTGGAAAAAGGCTAGGGGAATGTGGCACCTTCGGGTGTGTTATAGCCCTTAGTCACATACAGTGGTTGGGATCGAGGACCGCAGCACGCCTTTATGGCCGGGGTTCGCCCACGTTCGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGAC

Morphology Growth moderately rapid. After 2 weeks at 25°C colony of downy mycelium, mat white, slightly raised, cottony and floccose, becoming thin and felty.  Abundant clamp connections observed.
Name of Depositor Y Abe
Chain of Custody
ATCC <-- Y Abe <-- K Kitajima
Isolation
Wooden electric pole, Japan
Cross References

Nucleotide (GenBank) : MJIM00000000 Fomitopsis palustris strain ATCC 62978, whole genome shotgun sequencing project

References

Test methods for determining the effectiveness of wood preservatives and their performance requirements. Tokyo, Japan:Japanese Standards Association;JIS K 1571, 2004

Karim N, Shibuya H, Kikuchi T. Analysis of expressed sequence tags from the wood-decaying fungus Fomitopsis palustris and identification of potential genes involved in the decay process. J Microbiol Biotechnol 21: 347-358, 2011. PubMed: 21532317

Shimokawa T, et al. Purification, molecular cloning, and enzymatic properties of a family 12 endoglucanase (EG-II) from Fomitopsis palustris: role of EG-II in larch holocellulose hydrolysis. Appl Environ Microbiol 74: 5857-5861, 2008. PubMed: 18658283

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS