To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X
Search

Fusarium keratoplasticum Geiser et al. (ATCC® 36031™)

Strain Designations: FIV/74 [NRRL 22641]  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Fusarium solani (Martius) Saccardo
Classification Fungi, Dikarya, Ascomycota, Pezizomycotina, Sordariomycetes, Hypocreomycetidae, Hypocreales, Nectriaceae, Fusarium
Strain Designations FIV/74 [NRRL 22641]
Application
Testing
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments Proteolytic activity

The strain was re-identified as Fusarium keratoplasticum in the Fusarium solani species complex based on the multigene sequence analysis. This change does not affect to its use as quality control strain for standard tests.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTATACAACTCATCAACCCTGTGAACATACCTAAAACGTTGCTTCGGCGGGAACAGACGGCCCCGTAACACGGGCCGCCCCCGCCAGAGGACCCCCTAACTCTGTTTCTATTATGTTTCTTCTGAGTAAAACAAGCAAATAAATTAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAGGCCCCCGGGCCTGGCGTTGGGGATCGGCGAGGCGCCCCCTGCGGGCACACGCCGTCCCCCAAATACAGTGGCGGTCCCGCCGCAGCTTCCATTGCGTAGTAGCTAACACCTCGCAACTGGAGAGCGGCGCGGCCACGCCGTAAAACACCCAACTTCTGAATGTTGACCTCGAATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAATA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCATAGAGGGTGAGAGCCCCGTCTGGTTGGACACCGATCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTATATGTCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCTTGGTTGATCATCCGGGGTTCTCCCCGGTGCACTCTTCCGGCCCAGGCCAGCATCAGTTCGCCCTGGGGGACAAAGGCTTCGGGAATGTGGCTCTCTCCGGGGAGTGTTATAGCCCGTTGCGTAATACCCTGTGGCGGACTGAGGTTCGCGCATTCGCAAGGATGCTGGCGTAATGGTCATCAGTGAC


elongation factor (EF) 1-alpha gene

GTCGTCATCGGCCACGTCGACTCTGGCAAGTCGACCACCGTAAGTCAAACCCTCATCGCGATCTGCTTATCTCGGGTCGTGGAACCCCGCCTGGTATCTCGGGCGGGGTATTCATCAGTCACTTCATGCTGACAATCATCTACAGACCGGTCACTTGATCTACCAGTGCGGTGGTATCGACAAGCGAACCATCGAGAAGTTCGAGAAGGTTGGTGACATCTCCCCCGATCGCGCCTTGCTATTCCACATCGAATTCCCTCCCTCGCGATACGGTCTGCGCCCGCTTCTCCCGAGTCCCAAAATTTTTGCGGTCCGACCGTAATTTTTTTTTTGGTGGGGCATTTACCCCGCCACTCGGGCGACGTTGGACAAAGCCCTGATCCCTGCACACAAAAAACACCAAACCCTCTTGGCGCGCATCATCACGTGGTTCACAACAGACGCTAACCGGTCCAACAATAGGAAGCCGCTGAGCTCGGTAAGGGTTCCTTCAAGTACGCCTGGGTCCTTGACAAGCTCAAGGCCGAGCGTGAGCGTGGTATCACCATCGACATTGCCCTCTGGAAGTTCGAGACTCCCCGCTACTATGTCACCGTCATTGGTATGTTGCTGTCACCTCTCTCACACATGTCTCACCACTAACAATCAACAGACGCCCCCGGCCACCGTGATTTCATCAAG
Name of Depositor HC Gugnani
Isolation
Corneal ulcer in man, Anambra State, Nigeria
Cross References

Nucleotide (GenBank) : HQ026747 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU933418 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KU933434 elongation factor (EF) 1-alpha gene

References

Imamura Y, et al. Fusarium and Candida albicans biofilms on soft contact lenses: model development, influence of lens type, and susceptibility to lens care solutions. Antimicrob Agents Chemother 52: 171-182, 2008. PubMed: 17999966

Short, DPG. Phylogenetic relationships among members of the Fusarium solani species complex in human infections and the descriptions of F. keratoplasticum sp. nov. and F. petroliphilum stat. nov. Fungal Genet Biol 53: 59–70, 2013. PubMed: 23396261

Zhang, N. Members of the Fusarium solani species complex that cause infections in both humans and plants are common in the environment. J Clin Microbiol 44: 2186-2190, 2006. PubMed: 16757619

Ophthalmic optics--Contact lens care products--Microbiological requirements and test methods for products and regimens for hygienic management of contact lenses. Geneva (Switzerland):International Organization for Standardization/ANSI;ISO ISO 14729:2001.

Gugnani HC, et al. Mycotic keratitis in Nigeria. A study of 21 cases. Br. J. Ophthalmol. 60: 607-613, 1976. PubMed: 791355

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS
FAQs
  1. ATCC 36031 name change


    Date Updated: 12/18/2017