To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X
Search

Candida parapsilosis (Ashford) Langeron et Talice (ATCC® 22019-MINI-PACK™)

Strain Designations: CBS 604 [CCRC 20515, DBVPG 6150, DMS 5784, IBL 2545, IFO 1396, IGC 2545, JCM 1785, NCYC 601, NBRC 1396, NRRL Y-12969, UCD 61-27]  /  Product Format: frozen
6 ready-to-use vials of ATCC® 22019™ in glycerol stock

Permits and Restrictions

View Permits

Strain Designations CBS 604 [CCRC 20515, DBVPG 6150, DMS 5784, IBL 2545, IFO 1396, IGC 2545, JCM 1785, NCYC 601, NBRC 1396, NRRL Y-12969, UCD 61-27]
Application ATCC® 22019-MINI-PACK™ consists of 6 ready-to-use vials of ATCC® 22019™ frozen in 200 µL of glycerol stock, eliminating the need to rehydrate and culture the strain prior to use. Each vial is provided with a 2-D barcode for easy storage and tracking, as well as peel-off labels for fast and reliable recordkeeping.  Learn more about ATCC® MinisDeveloped by the leaders in microbial cultivation and preservation, ATCC® Minis provide a convenient, ready-to-use solution for handling quality control strains. ATCC® Minis are authenticated and backed by ATCC polyphasic testing – ensuring the same consistent and reliable reference materials you’ve come to trust for ATCC Genuine Cultures®. It is easy to ensure the quality of your products with ATCC® Minis – just open, plate, and go! .

Assay of itraconzaole
Assay of ketoconazole
Control strain for identification
Degrades hydroxybenzoate
Degrades phenol
Produces (S)-1,3-butanediol dehydrogenase
Produces lipase
Quality control
Quality control strain
Susceptibility disc testing
Susceptibility testing
Antifungal susceptibility testing RefGhannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006. RefEspinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.
Reference strain for Clinical and Laboratory Standards Institute(CLSI)-developed Antifungal Susceptibility Testing
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format frozen
6 ready-to-use vials of ATCC® 22019™ in glycerol stock
Storage Conditions -70°C or colder, store upright. Storage at -20°C is acceptable for up to 1 year.
Type Strain yes
Preceptrol® no
Comments
Esterase activity
Electrophoretic karyotype
RAPD profiles
This organism is a CLSI control strain for antimicrobial susceptibility testing.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

GGTGAACCTGCGGAAGGATCATTACAGAATGAAAAGTGCTTAACTGCATTTTTTCTTACACATGTGTTTTTCTTTTTTTGAAAACTTTGCTTTGGTAGGCCTTCTATATGGGGCCTGCCAGAGATTAAACTCAACCAAATTTTATTTAATGTCAACCGATTATTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCTCGGGTTTGGTGTTGAGCGATACGCTGGGTTTGCTTGAAAGAAAGGCGGAGTATAAACTAATGGATAGGTTTTTTCCACTCATTGGTACAAACTCCAAAACTTCTTCCAAATTCGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAA


D1D2 region of the 26S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCCAGACCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTCTCTCGGGGGTGGCCTCTACAGTTTACCGGGCCAGCATCAGTTTGAGCGGTAGGATAAGTGCAAAGAAATGTGGCACTGCTTCGGTAGTGTGTTATAGTCTTTGTCGATACTGCCAGCTTAGACTGAGGACTGCGGCTTCGGCCTAGGATGTTGGCATAATGATCTTAAGTCG
Name of Depositor CBS
Special Collection ATCC® Minis
Chain of Custody ATCC <-- CBS <-- BK Ashford
Isolation Case of sprue, Puerto Rico
Cross References

Nucleotide (GenBank) : M60307 small subunit ribosomal RNA

Nucleotide (GenBank) : L11352 5.8S ribosomal RNA gene, sequence

Nucleotide (GenBank) : U45754 26S ribosomal RNA gene, partial sequence

Nucleotide (GenBank) : U46004 Candida parapsilosis ribosomal RNA large subunit gene sequence.

Nucleotide (GenBank) : U10987 5.8S rRNA gene and internal transcribed spacers 1 and 2, complete sequence

Nucleotide (GenBank) : AF085429 ADP/ATP carrier protein gene, nuclear gene encoding mitochondrial protein, complete coding sequence

References

Rudek W. Esterase activity in Candida species. J Clin Microbiol 8: 756-759, 1978. PubMed: 370150

Ashford BK. Certain conditions of the gastro-intestinal tract in Porto Rico and their relation to tropical sprue. Am. J. Trop. Med. Hyg. 8: 507-538, 1928.

Lott TJ, et al. Genomic heterogeneity in the yeast Candida parapsilosis. Curr. Genet. 23: 463-467, 1993. PubMed: 8319303

Briand D, et al. Functioning and regioselectivity of the lipase of Candida parapsilosis (Ashford) Langeron and Talice in aqueous medium. New interpretation of regioselectivity taking acyl migration into account. Eur. J. Biochem. 228: 169-175, 1995. PubMed: 7883000

Zeng S, et al. Random amplified polymorphic DNA analysis of culture collection strains of Candida species. J Med Vet Mycol 34: 293-297, 1996. PubMed: 8873891

Lott TJ, et al. Nucleotide sequence analysis of the 5-8S rDNA and adjacent ITS2 region of Candida albicans and related species. Yeast 9: 1199-1206, 1993. PubMed: 8109169

Vazquez JA, et al. Comparison of restriction enzyme analysis versus pulsed-field gradient gel electrophoresis as a typing system for Torulopsis glabrata and Candida species other than C. albicans. J Clin Microbiol 31: 2021-2030, 1993. PubMed: 8396585

Brenner DJ, et al. Multisite reproducibility of colorimetric broth microdilution method for antifungal susceptibility testing of yeast isolates. J Clin Microbiol 32: 1625-1628, 1994. PubMed: 7929747

Lin D, et al. Three distinct genotypes within Candida parapsilosis from clinical sources. J. Clin. Microbiol. 33: 1815-1821, 1995. PubMed: 7665651

Yamamoto H, et al. Purification and characterization of (S)-1,3-butanediol dehydrogenase from Candida parapsilosis. Biosci. Biotechnol. Biochem. 59: 1769-1770, 1995. PubMed: 8520120

Briand D, et al. Factors affecting the acyltransfer activity of the lipase from Candida parapsilosis in aqueous media. J. Am. Oil Chem. Soc. 72: 1367-1373, 1995.

Rex JH, et al. Quality control guidelines for National Committee for Clinical Laboratory Standards--recommended broth macrodilution testing of ketoconazole and itraconazole. J. Clin. Microbiol. 34: 816-817, 1996. PubMed: 8815089

Nebohacova M, et al. Isolation and expression of the gene encoding mitochondrial ADP/ATP carrier (AAC) from the pathogenic yeast Candida parapsilosis. Yeast 15: 1237-1242, 1999. PubMed: 10487926

Kurtzman CP, Robnett CJ. Identification of clinically important ascomycetous yeasts based on nucleotide divergence in the 5' end of the large-subunit (26S) ribosomal DNA gene. J Clin Microbiol 35: 1216-1223, 1997. PubMed: 9114410

Barns SM, et al. Evolutionary relationships among pathogenic Candida species and relatives. J. Bacteriol. 173: 2250-2255, 1991. PubMed: 2007550

Middelhoven WJ, et al. Degradation of some phenols and hydroxybenzoates by the imperfect ascomycetous yeasts Candida parapsilosis and Arxula adeninivorans: evidence for an operative gentisate pathway. Antonie van Leeuwenhoek 62: 181-187, 1992. PubMed: 1416914

Sensititre™ YeastOne. Thermo Scientific™ Sensititre™ Systems, Trek Diagnostic Systems.

Quality Control MIC Limits for Broth Microdilution Informational Supplement. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M27-S3.

Method for Antifungal Disk Diffusion Susceptibility Testing of Yeast; Approved Guideline. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M44-A2.

Medical microbiology--Susceptibility testing of microbial pathogens to antimicrobial agents -- Part 84: Microdilution; Special requirements for testing of fungi against antifungal agents. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 58940-84: 2002, 2002

VITEK 2 Antifungal AST Card. bioMerieux.

Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi: Approved Standard - 2nd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A2.

VITEK 2 AST-YS QC Set. bioMerieux.

Espinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.

Ghannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006.

Abi-Chacra EA, et al. Phenotypical properties associated with virulence from clinical isolates belonging to the Candida parapsilosis complex. FEMS Yeast Res. 13: 831-848, 2013. PubMed: 24103069

Bisha B, Kim HJ, Brehm-Stecher BF. Improved DNA-FISH for cytometric detection of Candida spp. J Appl Microbiol 110: 881-892, 2011. PubMed: 21205104

Cornet M, et al. Molecular identification of closely related Candida species using two ribosomal intergenic spacer fingerprinting methods. J Mol Diagn 13: 12-22, 2011. PubMed: 21227390

Gunisova S, et al. Identification and comparative analysis of telomerase RNAs from Candida species reveal conservation of functional elements. RNA 15: 546-559, 2009. PubMed: 19223441

Borman AM, et al. Candida nivariensis, an emerging pathogenic fungus with multidrug resistance to antifungal agents. J. Clin. Microbiol. 46: 933-938, 2008. PubMed: 18199788

Kosa P, Gavenciakova B, Nosek J. Development of a set of plasmid vectors for genetic manipulations of the pathogenic yeast Candida parapsilosis. Gene 396: 338-345, 2007. PubMed: 17512139

Innings A, et al. Multiplex real-time PCR targeting the RNase P RNA gene for detection and identification of Candida species in blood. J Clin Microbiol 45: 874-880, 2007. PubMed: 17215340

Kosa P, et al. Complete DNA sequences of the mitochondrial genomes of the pathogenic yeasts Candida orthopsilosis and Candida metapsilosis: insight into the evolution of linear DNA genomes from mitochondrial telomere mutants. Nucleic Acids Res. 34: 2472-2481, 2006. PubMed: 16684995

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS
Other Documentation
Other Document
Need help retrieving the Certificate of Analysis for your ATCC Minis?