To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X
Search

Hormoconis resinae (Lindau) von Arx et de Vries (ATCC® 20495™)

Alternate State: Amorphotheca resinae Parbery  /  Strain Designations: [CBS 174.61, NRRL 6437, QM 7998]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Cladosporium resinae (Lindau) de Vries
Strain Designations [CBS 174.61, NRRL 6437, QM 7998]
Alternate State Amorphotheca resinae Parbery
Application
Assay of antimicrobial preservatives
Degrades starch
Produces alpha-glucosidase maltase
Produces amylase, alpha 1A; salivary Amylase, salivary, alpha-1A
Produces glucoamylase
Produces glucoamylase P
Produces glucoamylase S
Testing diesel fuel stabilizer additive
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Preceptrol® no
Morphology After 7 days mycelium pale brown.  Colony rust to orange powdery. Conidia formed in large conidial heads consisting of many lateral or terminal chains, smooth walled, hyaline to pale brown, 1-celled subglobular, elliptical or becoming cylindrical in the ramoconidia.  Later ascomata appearing as small black sclerotial bodies deep in the agar.  Asci 8-spored, subglobose to pyriform hyaline.  Ascospores 1-celled, ellipsoid, light brown.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACAGAGTTCGTGCCCTCACGGGTAGATCTCCCACCCTGTGCCGTCGTTACCTTTGCTGCTTTGGCGGGCCGCCGCCCGGCCGCCGGCTCACGCTGGCGCGCGCCCGCCAGAGGACCTCAACTCTTGTTTTTTAGTGTCGTCTGAGTACTATACAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAATCTTTGAACGCACATTGCGCCCTGTGGTATTCCGCAGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCTCTGCTTGGTGTTGGGCCCTGCCCGTCGCGGCCGGCCCTAAAATCAGTGGCGGTGCCGCTGGGCTCTGAGCGTAGTACATCTCTCGCTCCAGCGCCCCGCGGTGGCTTGCCAGAACCCCAACTTCTGTGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTTCAGGGTCCGAGTTGTAATTTGTAGAAGATGCTTCGGGTGTGGCTCCGGTCTAAGTTCCTTGGAACAGGACGTCATAGAGGGTGAGAATCCCGTCTGTGACCGGTCGCCTTCGCCCATGTGAAGCTCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGCAACCAGACTTGCGCGCGGTCGATCATCCGGTGTTCTCACCGGTGCACTCGGCCGCGCTCAGGCCAGCATCGGTCTGGGTGGTTGGATAAAGGCCTGGGGAATGTGGCTCCTCTCGGGGAGTGTTATAGCCCCAGGTGCAATGCAGCCTACCTGGACCGAGGACCGCGCTTCGGCTAGGATGCTGGCGTAATGGTTGTAAGCGAC
Morphology After 7 days mycelium pale brown.  Colony rust to orange powdery. Conidia formed in large conidial heads consisting of many lateral or terminal chains, smooth walled, hyaline to pale brown, 1-celled subglobular, elliptical or becoming cylindrical in the ramoconidia.  Later ascomata appearing as small black sclerotial bodies deep in the agar.  Asci 8-spored, subglobose to pyriform hyaline.  Ascospores 1-celled, ellipsoid, light brown.
Name of Depositor JJ Marshall
U.S. Patent Number
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Chain of Custody
ATCC <-- JJ Marshall <-- NLABS Collection
Isolation
Aircraft fuel tank
Cross References

Nucleotide (GenBank) : X67708 H.resinae gamP mRNA for 1,4-alpha-D-glucan glucohydrolase.

Nucleotide (GenBank) : X68143 H.resinae gamP gene for 1,4-alpha-D-glucan glucohydrolase.

References

Fagerstrom R, et al. Comparison of two glucoamylases from Hormoconis resinae. J. Gen. Microbiol. 136: 913-920, 1990. PubMed: 2116499

Marshall JJ. Starch-degrading benzymes derived from Cladosporium resinae. US Patent 4,211,842 dated Jul 8 1980

ASTM International Standard Test Method for Evaluation of Antimicrobials in Liquid Fuels Boiling Below 390 degrees. West Conshohocken, PA

Marshall JJ. Starch-degrading enzymes derived from Cladosporium resinae. US Patent 4,234,686 dated Nov 18 1980

McCleary BV, Anderson MA. Hydrolysis of alpha-D-glucans and alpha-D-glucooligosaccharides by Cladosporium resinae glucoamylases. Carbohydr. Res. 86: 77-96, 1980. PubMed: 6777040

Vainio AEI, et al. Cloning and expression of Hormoconis resinae glucoamylase P cDNA in Saccharomyces cerevisiae. Curr Genet 24: 38-44, 1993. PubMed: 8358830

Joutsjoki VV, Torkkeli TK. Glucoamylase P gene of Hormoconis resinae: molecular cloning sequencing and introduction into Trichoderma reeaei. FEMS Microbiol Lett 99: 237-244, 1992.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS