To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. Our first job is to listen to and observe what our customers need, and meet those needs with quality products and services. While we are not currently experiencing delays due to this pandemic, we expect that we could see them as the situation evolves. If you experience any issues, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you for your understanding, patience and flexibility as ATCC does everything it can to help reduce the impact of the coronavirus pandemic to our valued customers.
X
Search

Postia placenta (Fries) Larsen et Lombard (ATCC® 11538_TT™)

Strain Designations: Madison 698 [ATCC 44197, Boat-106, CSIRO DFP 7522, FP 94267]  /  Product Format: test tube

Permits and Restrictions

View Permits

Deposited As Poria monticola Murrill
Strain Designations Madison 698 [ATCC 44197, Boat-106, CSIRO DFP 7522, FP 94267]
Application
Degrades coal
Degrades glycosides
Degrades polysaccharides
Fungus resistance testing wood
Produces endoglucanase
Resistant to copper compounds
Resistant to zinc compounds
Testing wood preservatives
Produces extracellular polysaccharide- and glycoside-degrading enzymes
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format test tube
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments
Does not degrade cellulose in the absence of wood
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions Temperature: 25°C to 30°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAATGAATTTTGAAAGGGGTTGTAGCTGGCCTTTTAGGAGGCATGTGCACACCCTGCTCTTCCATTCTTACACCTGTGCACACTTGTAGGTCGGTTTGAGCGGTTCTCTCTAACGGGGGATGCTGTTTGGCCTTCCTATGTTTTATAACAAACTCTGTAATGTCATAGAATGTCATCGCGTATAACGCATTATAATATAACTTTCAGCAACGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCTGGGTATTCCGAGGAGCATGCCGTTTGAGTGTCATGGAATTCTCAACCCTCTTATCCTTGTGGTGAGATTGGGTTGGATTTGGAGGTTTATGCTGGCTTGTAATGAGTCGGCTCCTCTTGAATGCATTAGCTTGGACCTTTGCGGACCACTTTTCGGTGTGATAATTGTCTACGCCGTGGGCTGTGATGCTGTTTAACATGCTTCGGTGTGTTGGGGTTCTGCTTCTAATGGTCCCTT
Name of Depositor FF Lombard
Chain of Custody ATCC <-- FF Lombard <-- RW Davidson Boat-106
Isolation Douglas-fir boat timbers, Maryland
References

Cohen MS, Gabriele PD. Degradation of coal by the fungi Polyporus versicolor and Poria monticola. Appl. Environ. Microbiol. 44: 23-27, 1982.

Wolter KE, et al. A unique polysaccharide- and glycoside-degrading enzyme complex from the wood-decay fungus Poria placenta. Biochem. Biophys. Res. Commun. 97: 1499-1504, 1980. PubMed: 7213375

Clausen CA. Dissociation of the multi-enzyme complex of the brown-rot fungus Postia placenta. FEMS Microbiol Lett 127: 73-78, 1995.

ASTM International Standard Test Method for Wood Preservatives by Laboratory Soil-block Cultures. West Conshohocken, PA:ASTM International;ASTM Standard Test Method D 1413-07.

AWPA Standard method of testing wood preservatives by laboratory soil-block cultures. Birmingham, AL: American Wood-Preservers' Association; AWPA E10-06, 2006

Da Costa EW. Comparison of three organic fungicides as light oil solvent preservatives. Holzforschung 33: 65-67, 1979.

Smith RS. Proposed standard method of testing wood preservatives by soil-block cultures and respiration analysis. Proc. Am. Wood Preserv. Assoc. 72: 222-229, 1976.

Highley TL. Can wood-rot fungi degrade cellulose without other wood constituents?. For. Prod. J. 25: 38-39, 1975.

Butcher JA, Preston AF. Toxicity of tertiary amine acetates against basidiomycetes and soft-rot fungi. N.Z. J. For. Sci. 8: 397-402, 1978.

Accelerated laboratory procedure for evaluating the efficacy of diffusible or volatile internal remedial preservatives. Birmingham, AL: American Wood-Preservers' Association;AWPA E15-03, 2006

Standard accelerated laboratory method for testing the efficacy of preservatives against wood decay fungi using compression strength. Birmingham, AL: American Wood-Preservers' Association; AWPA E22-06, 2006

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS