To ATCC Valued Customers,

ATCC stands ready to support our customers’ needs during the coronavirus pandemic. If you experience any issues with your products or services, please contact ATCC Customer Service at sales@atcc.org. For Technical questions please contact tech@atcc.org. Thank you.
X

Privacy Policy Update

We remain dedicated to protecting your data and experience throughout our platforms. We have updated our Privacy Policy and your continued use of the Site means you have accepted the revised Privacy Policy. View now >
X
Search

Irpex lacteus Fries (ATCC® 11245™)

Strain Designations: Madison 517  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Polyporus tulipiferae (Schweinitz) Overholts
Strain Designations Madison 517
Application
fungus resistance testing
testing wood preservatives
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACTGCGAGTGAAGCGGGAAAAGCTCAAATTTAAAATCTGGCGGCTTTGGTCGTCCGAGTTGTATTCTAGAGAAGTGTTTTCCGCGTTGGACCGTGTATAAGTCTCTTGGAATAGAGCGTCATAGAGGGTGAGAATCCCGTCTTTGACACGGACTACCAATGCTTTGTGATACACTCTCAAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGCTGAAAGGGAAACGCTTGAAGTCAGTCGCGTTAGCTAGAACTCAACCAGGCTTGCTTGGCGTATTTTCTAGTTAACGGGCCAGCATCAGTTTTGACCGCAGGAAAAGGGCCAGGGAAATGTGGCATCTTCGGATGTGTTATAGTCTCTGGTCGTATACTGTGATTGGGACTGAGGACCGCAGCACGCGCAAGCTGTGCTTAGGATGCTGGCGTAATGGCTTTAAACGA
Name of Depositor FF Lombard
Isolation
Mine timber, Pennsylvania
References

Standard accelerated laboratory method for testing the efficacy of preservatives against wood decay fungi using compression strength. Birmingham, AL: American Wood-Preservers' Association; AWPA E22-06, 2006

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • USDA APHIS PPQ Permit 526, plant pathogens permit must be obtained and a copy of the permit must be sent to ATCC in advance of shipment. Isolation information for this item is required by USDA. Please check our website or contact Technical Service for assistance. Domestic isolates are easier to obtain than foreign isolates.
  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Product Sheet
Product Sheet
Certificate of Analysis
Certificate of Analysis
SDS
SDS