Cryptococcus diffluens (Zach) Lodder & Kreger-van Rij (ATCC® MYA-4948)

Strain Designations: HD-40  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Cryptococcus sp.
Strain Designations HD-40
Application Produces pheomelanins
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments Produces pheomelanins
Epidemiological study
Morphology On YM medium at 25°C after 4 days, colonies creamy white to dingy white, smooth, mucoid, margin entire. Cells hyaline, subglobose to ellipsoidal, smooth, 4-6 X 4-5 µm. Pseudohyphae not observed.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

AAGGATCATTAATGATTAACTGTCTGTCGAGCTTGCTCACAGACTTATCATATCCATAACACCTGTGCACTTGTCGGATGGCTTAGTGAAGACCGCAAGGTTGGATCTATCCATCTACTTTACATAACAATCTAGTAACAAATGTAGTCTTATTATAACATAATAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCTCCCTGGTATTCCGGGGAGCATGCCTGTTTGAGTGTCATGAAAACCCTCAACCTTAGATTGGTTAACACCTTTCTTTGGCTTGGATTTGGACGTTTGCCGATGATAAGTCGGCTCGTCTTAAAAGTAATAGCTGGATCTGTCTCGCGACATGGTTTGACTTGGCGTAATAAGTATTTCGCTAAGGACATCTTCGGATGGCCGCGTTGCAAGACTAAAGACCGCTTTCTAATCCATTGATCTTCGGATTAATATTCTTGACATCTGGCCTCAAATCAGGTAGGACTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene:

GGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAATTTGAAATCTAGTAGCCTTCGGCTGCTCGAGTTGTAATCTAGAGAAGTGTTTTCCGTGCCGGCCCATGTACAAGTCCCTTGGAACAGGGCGTCATAGAGGGTGAGAATCCCGTCCTTGACATGGACCCCCGGTGCTCTGTGATACACTTTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCATGCTCTTTGGTATTTATATCATTGAGTGGGGTCAACATCAGTTTTGAGCGATGGATAAAGGCACTAGGAAGGTAGCACTCTCGGGTGAACTTATAGCCTAGCGTCATATACATTGTTTGGGACTGAGGAACGCAGCATGCCTTTATGGCCGGGATTCGTCCACGTACATGCTTAGGATGTTGACATAATGGCTTTAAACGA

Morphology On YM medium at 25°C after 4 days, colonies creamy white to dingy white, smooth, mucoid, margin entire. Cells hyaline, subglobose to ellipsoidal, smooth, 4-6 X 4-5 µm. Pseudohyphae not observed.
Name of Depositor H Dhillon
Chain of Custody ATCC <-- H Dhillon
Isolation Pinus roxburghii, Solan, Himachal Pradesh, India.
References

Dhillon H, Sharma DR. Extracellular Deoxyribonuclease and Hemolysins Production by Cryptococcus species. Int. J. New Horiz. Pharm. Biomed. Sci. 1: 13-24, 2013.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation