Phytophthora pluvialis Reeser et al. (ATCC® MYA-4930)

Strain Designations: LC-9.2-020508  /  Product Format: frozen

Strain Designations LC-9.2-020508
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Comments Plant pathogen
Morphology After 10 days on V8 Rye medium at 20°C, colony appressed, cream-colored. Oogonia terminal, smooth, globose, golden orange, with amphigynous antheridia.
Medium ATCC® Medium 323: Malt agar medium
ATCC® Medium 343: V8 juice agar
ATCC® Medium 1970: V8 rye agar
Growth Conditions
Temperature: 15°C to 20°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AAGGATCATTACCACACCTAAAAAACTTTCCACGTGAACTGTATCGAACAACTAGTTGGGGGTCTTGTTTGGCGTGCGGCTGCTTCGGTAGCTGCTGCTAGGCGAGCCCTATCACGGCGAGCGTTTGGACTTCGGTCTGAACTAGTAGCTATTTTTTAAACCCATTCTTTAATACTGATTATACTGTGGGGACGAAAGTCTCTGCTTTTAACTAGATAGCAACTTTCAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATACGTAATGCGAATTGCAGGATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCACTTCCGGGTTAGTCCTGGGAGTATGCCTGTATCAGTGTCCGTACATCAAACTTGGCTTTCTTCCTTCCGTGTAGTCGGTGGAGGAGACGCCAGACGTGAAGTGTCTTGCGGCGAATTTTCGAATTTGCTGTGAGTCCTTTGAAATGTACTGAACTGTACTTCTCTTTGCTCGAAAAGCGTGGCGTTGCTGGTTGTGGAGGCTGCCCGCGTGGCCAGTCGGCGACCGGTTTGTCTGCTGTGGCATTAATGGAGGAGTGTTCGATTCGCGGTATGGTTGGCTTCGGCTGAACAAGCGCTTATTGGATGTTCTTCTTGCTGTGGCGTGACGGACTGGTGAACCGTAGCTATGTGTGGCTTGGCTTTTGAATCGGCTTTGCTGTTGCAAAGTAGAGTGGCGGCTTCGGCTGTCGAGGGTCGATCCATTTGGGAAATTTGTGTGTATGACTTCGGTTGTATGCATCTCAATTGGACCTGATATCAGGCAAGATTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene.

CATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGCGGGAAGAGCTCAAGCTTAAAATCTCCGTGCAAGTTTTGCACGGCGAATTGTAGTCTATAGAGGCGTGGTCAGCGTGGGCGCTTGGGGCAAGTTCCTTGGAAGAGGACAGCATGGAGGGTGATACTCCCGTTCATCCCTGAGTTGCTCGTGCGTACGACCCGTTTTCTTTGAGTCGCGTTGTTTGGGAATGCAGCGCAAAGTAGGTGGTAAATTCCATCTAAAGCTAAATATTGGTGCGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAAGAGTACCTGAAACTGCTGAAAGGGAACCGAATCGTTTCCAGTGTCTATAATCCGTGGCATATTTCATTGGCGAGTGTGCGCGTGCGTGTGCTGTGGCAGCGGTCTTTATGGCTGCGCTCGGCGTGTGTGCTGTGTGTGCTTGCTGGTGCCCTGTGCTGCGGTGGGACGTCAAGGTCAGTTCGTATGCTGCGGGAAATGGCTGCCGAGGAGGTAGGGCTTACGCTCCGCGTTTGTCTGTTATATCTTGGTGGACGAGTCGTCGCGGTTGGGACTGAGGTGCCTACAACGTGCTTTTGAGTGGGTTTGTGTCTCCGTGTGCGCCGTGTGCGGATAGCTTGCTATGCGTGTGTGGTTGTGTGTGGATTGATGCGGGCCTTAACTTGTTGCCGTTCGGGACGTTGACGAAATGGAGCGATCCGAC

Morphology After 10 days on V8 Rye medium at 20°C, colony appressed, cream-colored. Oogonia terminal, smooth, globose, golden orange, with amphigynous antheridia.
Name of Depositor P Reeser
Chain of Custody ATCC <-- P Reeser
Isolation Rain collected under forest canopy, Curry County, Oregon, USA
References

Reeser P, Sutton W, Hansen E. Phytophthora pluvialis, a new species from mixed tanoak-Douglas-fir forests of western Oregon, U.S.A. North American Fungi 8(7): 1-8. 2013.