Fusarium verticillioides (Saccardo) Nirenberg (ATCC® MYA-4922)

Strain Designations: FGSC 7600 [A-00149, M3125]  /  Product Format: frozen

Deposited As Fusarium verticilliodes
Strain Designations FGSC 7600 [A-00149, M3125]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Genotype VCG A7
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type mating type A-
Comments

Genome sequencing strain (Broad Institute, USA).

Morphology After 4 days on potato dextrose medium at 25°C, colony is white, cottony, tinged with purple. Microconidia abundant, single-celled, oval, formed in false heads on monophialides. Macroconidia present, sickle-shaped to straight, 3-5 septate.
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 323: Malt agar medium
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCAGCTTGGTGTTGGGACTCGCGAGTCAAATCGCGTTCCCCAAATTGATTGGCGGTCACGTCGAGCTTCCATAGCGTAGTAGTAAAACCCTCGTTACTGGTAATCGTCGCGGCCACGCCGTTAAACCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAG


Partial caM gene for calmodulin.

TCTTTGTAAGCTATCCCCTTTGTTTCGCCGCCTTGCCTAGCCGGGTCTTGTGAGAAGCTGTCGCTAACCTCTTTATGTAGGACAAGGATGGCGATGGTGAGTGATGCTCCCCTTCCTGCGATGTTTCTCCGTTGGCCCCGTGCGAAACCCAAATCGATCCAACAAAGCATGCATCAGACCACTATAATCCTTTACATCTCTGTCTATGCGATATTCTTAAATCGAAAACATGAGCTAAACGCCTCGCTCTAGGCCAGATTACCACCAAGGAGCTCGGTACCGTTATGCGCTCTCTCGGCCAGAACCCCTCCGAGTCTGAGCTTCAGGACATGATCAACGAGGTTGACGCTGACAACAACGGCACCATCGACTTTCCTGGTTCGTAGTATCCCAAGACGATTATAGGACGGTCGAGTACTAACCATTAGGTAAAGAGTTCCTTACCATGATGGCC

Morphology After 4 days on potato dextrose medium at 25°C, colony is white, cottony, tinged with purple. Microconidia abundant, single-celled, oval, formed in false heads on monophialides. Macroconidia present, sickle-shaped to straight, 3-5 septate.
Name of Depositor FGSC
Chain of Custody ATCC <-- FGSC <--Leslie JF
Isolation Maize, Visalia, CA, USA
Cross References

Complete Genome (GenBank) : AAIM00000000 Fusarium verticillioides 7600, whole genome shotgun sequencing project

References

Ma LJ, et al. Comparative genomics reveals mobile pathogenicity chromosomes in Fusarium. Nature 464: 367-373, 2010. PubMed: 20237561

Xu JR, et al. Electrophoretic karyotypes distinguish the biological species of Gibberella fujkuroi (Fusarium section Liseola). Mol. Plant-Microbe Interact. 8: 74-84, 1995.