Trichoderma spirale (ATCC® MYA-4917)

Strain Designations: TUB F-825  /  Product Format: frozen

Classification Ascomycota, Pezizomycotina, Sordariomycetes, Hypocreomycetidae, Hypocreales, Hypocreaceae
Strain Designations TUB F-825
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Morphology On PDA medium at 25°C after 8 days, mycelium white with green tint, cottony, dense. Reverse yellowish tan. Hyphae hyaline, guttulate. Conidiophores hyaline, branched. Phialides obclavate, single or in groups of 2-3, 12 x 3-3.75 µm. Conida green, broadly ellipsoidal, smooth, 3.75-4.5 x 2.25-3 µm.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number KC581161:

AGGGATCATTACCGAGTTTACAACTCCCAAACCCAATGTGAACGTTACCAAACTGTTGCCTCGGCGGGATCTCTGCCCCGGGTGCGTCGCAGCCCCGGACCAAGGCGCCCGCCGGAGGACCAACCAAAACTCTTTTGTATACCCCCTCGCGGGTTTTTTATATCTGAGCCATCTCGGCGCCTCTCGTAGGCGTTTCGAAAATGAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTCCGAGCGTCATTTCAACCCTCGAACCCCTCCGGGGGGTCGGCGTTGGGGATCGGCCCTTTACGGGGCCGGCCCCGAAATACAGTGGCGGTCTCGCCGCAGCCTCTCCTGCGCAGTAGTTTGCACACTCGCATCGGGAGCGCGGCGCGTCCATTGCCGTAAAACACCCAACTTTCTGAAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene; GenBank number KC581159:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCTCGGGGTCCGAGTTGTAATTTGTAGAGGATGCTTTTGGTGAGGTGCCGCCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTCTGGCTGGCCACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACCTTGAAAAGAGGGTTAAATAGTACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGGGCGCGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCGCGTCTAGGCCAGCATCAGTTCGTCGCGGGGGAAAAAGGTTTCGGGAACGTGGCTCCTCCGGGAGTGTTATAGCCCGTTGCATAATACCCTGCGGTGGACTGAGGACCGCGCATCTGCAAGGATGCTGGCGTAATGGTCACCAGCGA

Morphology On PDA medium at 25°C after 8 days, mycelium white with green tint, cottony, dense. Reverse yellowish tan. Hyphae hyaline, guttulate. Conidiophores hyaline, branched. Phialides obclavate, single or in groups of 2-3, 12 x 3-3.75 µm. Conida green, broadly ellipsoidal, smooth, 3.75-4.5 x 2.25-3 µm.
Name of Depositor G. Szakacs
Chain of Custody ATCC <-- G. Szakacs; Budapest University of Technology and Economics
Isolation Soil, Botanical Garden; Rio de Janeriro, Brazil.
Cross References

Nucleotide (GenBank) : KC581161 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Nucleotide (GenBank) : KC581159 D1D2 region of the 28S ribosomal RNA gene

References

Druzhinina IS, et al. An oligonucleotide barcode for species identification in Trichoderma and Hypocrea. Fungal Genet. Biol. 42: 813-828, 2005.