Candida parapsilosis (Ashford) Langeron et Talice, anamorph (ATCC® MYA-4646)

Strain Designations: CDC 317  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations CDC 317
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Genome Sequenced Strain

Yes

Comments
Genome sequencing strain (Wellcome Trust Sanger Insititute, UK).
Morphology Colonies on YM agar at 25°C after 3 days cream-colored, flat to umbonate, semi-dull to glistening smooth. Yeast-like cells globose to oval single or budding.
Sequenced Data
ITS DNA sequence of MYA-4646  

GAACCTGCGGAAGGATCATTACAGAATGAAAAGTGCTTAACTGCATTTTTTCTTACACATGTGTTTTTCTTTTTTTGAAAACTTTGCTTTGGTAGGCCTTCTATATGGGGCCTGCCAGAGATTAAACTCAACCAAATTTTATTTAATGTCAACCGATTATTTAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCTCGGGTTTGGTGTTGAGCGATACGCTGGGTTTGCTTGAAAGAAAGGCGGAGTATAAACTAATGGATAGGTTTTTTCCACTCATTGGTACAAACTCCAAAACTTCTTCCAAATTCGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATA

 

D1D2 DNA sequence of MYA-4646

GGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACTTTCAGTGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGTCCCAGACCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTCTCTCGGGGGTGGCCTCTACAGTTTACCGGGCCAGCATCAGTTTGAGCGGTAGGATAAGTGCAAAGAAATGTGGCACTGCTTCGGTAGTGTGTTATAGTCTTTGTCGATACTGCCAGCTTAGACTGAGGACTGCGGCTTCGGCCTAGGATGTTG

Morphology Colonies on YM agar at 25°C after 3 days cream-colored, flat to umbonate, semi-dull to glistening smooth. Yeast-like cells globose to oval single or budding.
Name of Depositor M Ghannoum
Special Collection ATCC
Chain of Custody
ATCC <-- M Ghannoum
Isolation
health-care worker's hand
Cross References

Complete Genome (GenBank) : CABE00000000 Candida parapsilosis CDC317, whole genome shotgun sequencing project

References

Butler G, et al. Evolution of pathogenicity and sexual reproduction in eight Candida genomes. Nature 459: 657-662, 2009. PubMed: 19465905

Kuhn DM, et al. Candida parapsilosis characterization in an outbreak setting. Emerg. Infect. Dis. 10: 1074-1081, 2004.

Rossignol T, et al. Transcriptional response of Candida parapsilosis following exposure to farnesol. Antimicrob. Agents Chemother. 51: 2304-2312, 2007.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation