Bandoniozyma complexa (ATCC® MYA-4603)

Strain Designations: MA28a [CBS 11570]  /  Product Format: frozen

Deposited As Cryptococcus sp.
Classification Fungi, Basidiomycota, Agaricomycotina, Tremellomycetes, Incertae sedis, Tremellales, Tremellaceae
Strain Designations MA28a [CBS 11570]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions -70°C or colder
Type Strain yes
Preceptrol® no
Comments Ferments glucose
Morphology On YM medium at 25°C after 3 days, White to creamy white, smooth circular to slightly irregular, entire margin becoming filamentous with age, dull, raised. Cells smooth, globose to subglobose, single, 2.25-4.5 X 2.25-4.5 µm. Pseudohyphae observed after 16 days.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence; GenBank number KC113636:

AAGGATCATTATTGATTGGCCTAACGGCCGTTTCATTAACTCCAAACCTCTGTGAACCGTTGACCTCCGGGTCTATACAAACATTAGTGTAATGAACGTCTTTGTATTTTAACAAAACAAAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGTATTCCGAAAGGCATGCCTGTTTGAGTGTCATGAAATCTCAACCCCTCCAGGTTTCTGATCTGGGGGCGGCTTGGACTTGGACGTGTGCCAGCTAATGGCTCGTCTTAAAAGGATTAGTGGAATCTCGACATCCACGGCAGACGTAATAAGTTTCGTCTCGCCTCTTGTCGTAGGTCTGCTCACAACCTGCCATCGCGCACCTTTATGACTCTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene; GenBank number KC113632:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAACCGGGATGAGCTCAAATTTGAAATCTGGCGTCCTCAGGGCGTCCGAGTTGTAATCTATAGAGGCGTTTTCCGTGCCGGACCGTGTCCAAGTCCCTTGGAACAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGACGACCGGTGCTCTGTGATACGTCTTCTACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTGAGTTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGACTGTTGGGCTCAGCAGGTTCTGCCTGTGTATTCCCTTCAGTCGGGTCAACATCAGTTTTGACCGGTGGATAAGGGCAGCAGGAATGTGGCACCCTCGGGTGTGTTATAGCCTGTCGTCGCATACATCGGTCGAGACTGAGGAACGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTCCGAGCTTAGGATGTTGACATAATGGCTTTAAACGA

Morphology On YM medium at 25°C after 3 days, White to creamy white, smooth circular to slightly irregular, entire margin becoming filamentous with age, dull, raised. Cells smooth, globose to subglobose, single, 2.25-4.5 X 2.25-4.5 µm. Pseudohyphae observed after 16 days.
Name of Depositor P Valente
Chain of Custody ATCC <-- P Valente
Isolation Air sample from timber factory, Rio Grande do Sul, Brazil.
Cross References

Nucleotide (GenBank) : KC113632 D1/D2 region of 28S rRNA gen

Nucleotide (GenBank) : KC113636 ITS including 5.8S rRNA gene

References

Valente P, et al. Bandoniozyma gen. nov., a genus of fermentative and non-fermentative tremellaceous yeast species. PLoS ONE, 7: e46060, 2012. PubMed: 23056233