Panellus stipticus (Bulliard : Fries) Karsten, teleomorph (ATCC® 24513)

Strain Designations: F2118  /  Product Format: frozen

Deposited As Panus stipticus Bulliard : Fries, teleomorph
Strain Designations F2118
Application
Interfertility studies
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Comments
Non-luminescent
Interfertility studies
Morphology After 15 days on YM medium at 25°C, colonies are flat, white, reverse tan. Hyphae are hyaline, monomitic, lacking clamp connections.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AGGATCATTATTGAATACGCTTTGGGTGTTGACGCTGGCCTTTCGAGGCATGTGCTCGCATTCAAAACTGTTTAATCTTCACTTGTGCACCTTTTGTAGTCTTTTGAAGTCATCTCCGCTGCAAATGCGGGTTTTTGGGAGTCTGTCTCCCTGGGCTTCAGAGACTATGTTTTCATATACATTGAAAAGTTACAGAATGTCTTCTTATCGGCCGCGAGGCCTTTATAAACTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTATCAACCTTGAAGGCTTTCGTGGTCTTCTAGGCTTGGATGTGAGGGCTTGCTGGCTTCCTTCAGTGGATTGGTCTGCTCCCTTTAAATGCATTAGTAGGATCCTCTTGTGGAACCGTCGCTCGGTGTGATAATTATCTACGCCGTACTGACTTGCAATGAGAGCCTGCTTATAACTGTCTTCGGACAAGCTTCTTTAATATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG

Morphology After 15 days on YM medium at 25°C, colonies are flat, white, reverse tan. Hyphae are hyaline, monomitic, lacking clamp connections.
Name of Depositor ME Elliott
Isolation
Quercus pedunculata stump, Germany
References

. . Can. J. Res. Sect. C Bot. Sci. 20: 411-434, 1942.