Panellus stipticus (Bulliard : Fries) Karsten, teleomorph (ATCC® 24513)

Strain Designations: F2118  /  Product Format: frozen

Deposited As Panus stipticus Bulliard : Fries, teleomorph
Strain Designations F2118
Application
Interfertility studies
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Comments
Non-luminescent
Interfertility studies
Morphology After 15 days on YM medium at 25°C, colonies are flat, white, reverse tan. Hyphae are hyaline, monomitic, lacking clamp connections.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 20°C to 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

AGGATCATTATTGAATACGCTTTGGGTGTTGACGCTGGCCTTTCGAGGCATGTGCTCGCATTCAAAACTGTTTAATCTTCACTTGTGCACCTTTTGTAGTCTTTTGAAGTCATCTCCGCTGCAAATGCGGGTTTTTGGGAGTCTGTCTCCCTGGGCTTCAGAGACTATGTTTTCATATACATTGAAAAGTTACAGAATGTCTTCTTATCGGCCGCGAGGCCTTTATAAACTTAATACAACTTTCAACAACGGATCTCTTGGCTCTCCCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGTGTCATTAAATTATCAACCTTGAAGGCTTTCGTGGTCTTCTAGGCTTGGATGTGAGGGCTTGCTGGCTTCCTTCAGTGGATTGGTCTGCTCCCTTTAAATGCATTAGTAGGATCCTCTTGTGGAACCGTCGCTCGGTGTGATAATTATCTACGCCGTACTGACTTGCAATGAGAGCCTGCTTATAACTGTCTTCGGACAAGCTTCTTTAATATTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAG

Morphology After 15 days on YM medium at 25°C, colonies are flat, white, reverse tan. Hyphae are hyaline, monomitic, lacking clamp connections.
Name of Depositor ME Elliott
Isolation
Quercus pedunculata stump, Germany
References

. . Can. J. Res. Sect. C Bot. Sci. 20: 411-434, 1942.