Pestalotiopsis sp. (ATCC® 11816)

Strain Designations: QM531 [Pan H5 F1A]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Pestalotia royenae (Saccardo) Steyaert, anamorph
Strain Designations QM531 [Pan H5 F1A]
Application
produces carbomycin derivatives magnamycin derivatives
produces leucomycin derivatives
produces niddamycin derivatives
produces steroids
production of oxygenated steroids
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Type Strain no
Preceptrol® no
Morphology On PDA media at 25°C after 8 days, mycelium creamy white to tan, cottony in patches, becoming darker with age as conidia develop. Hyphae hyaline, guttulate. Conidia hyaline becoming reddish brown with age, segmented, sometimes bent, with 1-4 appendages, 13.5-16.5 X 6 µm.
Medium ATCC® Medium 336: Potato dextrose agar (PDA)
Growth Conditions
Temperature: 24°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

AGGGATCATTATAGAGTTTTCTAAACTCCCAACCCATGTGAACTTACCTTTTGTTGCCTCGGCAGAAGTTATAGGTCTTCTTATAGCTGCTGCCGGTGGACCATTAAACTCTTGTTATTTTATGTAATCTGAGCGTCTTATTTTAATAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCTAGCTTAGTGTTGGGAATCTACTTCTTTATAGTTGTAGTTCCTGAAATACAACGGCGGATTTGTAGTATCCTCTGAGCGTAGTAATTTTTTTCTCGCTTTTGTTAGGTGCTATAACTCCCAGCCGCTAAACCCCCAATTTTTTGTGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA

 

D1D2 region of the 28S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCTTGGGTCCGAATTGTAATTTGTAGAGGATGATTTTGGTGCGGTATCTTCCGAGTTCCTTGGAACAGGACGCCTTAGAGGGTGAGAGCCCCGTACGGTTGAATGCCTAGCCTCTGTAAATCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAATAGCACGTGAAATTGTTGAAAGGGAAGGATTTGTGACCAGACTTTTTCTGGGCGGATCATCCGGGGTTCTCTCCGGTGCACTTCGCCCAGTAAAGGCCAGCATCGGTTTTCGGCGTGGGATAAAAGCAGTAGGAATGTGGCTCTCTACGGGGAGTGTTATAGCCTGTTGTATAATACCGCGCTGGGGACCGAGGTTCGCGCTTCTGCAAGGATGCTGGCGTAATGGTTATCAATCA

Morphology On PDA media at 25°C after 8 days, mycelium creamy white to tan, cottony in patches, becoming darker with age as conidia develop. Hyphae hyaline, guttulate. Conidia hyaline becoming reddish brown with age, segmented, sometimes bent, with 1-4 appendages, 13.5-16.5 X 6 µm.
Name of Depositor Chas. Pfizer & Co., Inc.
Chain of Custody
ATCC <-- Chas. Pfizer & Co., Inc. <-- QM 531
Isolation
textile sample, Panama
U.S. Patent Number
References

Theriault RJ. Mycarosyl macrolide antibiotics. US Patent 3,784,447 dated Jan 8 1974

Shull GM, et al. Oxygenation of steroids in the 11-position. US Patent 2,721,163 dated Oct 18 1955

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation