Trichophyton rubrum (Castellani) Sabouraud (ATCC® 28188)

Strain Designations: 379 [44252]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations 379 [44252]
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety  classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTAACGCGCAGGCCGGAGGCTGGCCCCCCACGATAGGGACCGACGTTCCATCAGGGGTGAGCAGACGTGCGCCGGCCGTACGCCCCCATTCTTGTCTACCTCACCCGGTTGCCTCGGCGGGCCGCGCTCCCCCTGCCAGGGAGAGCCGTCCGGCGGGCCCCTTCTGGGAGCCTCGAGCCGGACCGCGCCCGCCGGAGGACAGACACCAAGAAAAAATTCTCTGAAGAGCTGTCAGTCTGAGCGTTTAGCAAGCACAATCAGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTCTGGCATTCCGGGGGGCATGCCTGTTCGAGCGTCATTTCAACCCCTCAAGCCCGGCTTGTGTGATGGACGACCGTCCGGCCCCTCCCTTCGGGGGCGGGACGCGCCCGAAAAGCAGTGGCCAGGCCGCGATTCCGGCTTCCTAGGCGAATGGGCAGCCAATTCAGCGCCCTCAGGACCGGCCGCCCTGGCCCCAATCTTTATATATATATATATCTTTTCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCTCCCCCGGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGGCGCGGCCCCCGTCTAAGTTCCTTGGAACAGGACGTCAGAGAGGGTGAGAATCCCGTCTTGGGCGGGCGGCCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGCGGGTGGTAAATTTCATCTAAAGCTAAATACCGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGGTTAAAAGCACCTTGAAAAGGGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGGCCAGACTCGGGGGGCGGGGTTCAGCGGGCGCTCGTCGCCCGTGCACTGCCCGCTCCCCGGGCCAGCATCAGCTTCGACGGCCGGTCAAAGGCCCCCGGAATGTGTCGTCTCTAGGGACGTCTTATAGCCGGGGGTGCAATGCGGCCCGTCGAGACTGAGGAACGCGCTCCGGCTCGGATGCTGGCGTAATGGCCGTAAGCGGC

Name of Depositor MA Gordon
Isolation
Human lesion, New York
Cross References

Nucleotide (GenBank) : KU729093 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729197 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : AF170472 Trichophyton rubrum strain ATCC 28188 18S ribosomal RNA gene,

References

Salkin IF. Dermatophyte test medium: evaluation with nondermatophytic pathogens. Appl. Microbiol. 26: 134-137, 1973. PubMed: 4795526

Salkin IF, Hurd N. Quantitative evaluation of the antifungal properties of cycloheximide. Antimicrob. Agents Chemother. 1: 177-184, 1972. PubMed: 5065214

Ghannoum M, et al. Multilaboratory evaluation of in vitro antifungal susceptibility testing of dermatophytes for ME1111. J. Clin. Microbiol. 2015 Dec 30. pii: JCM.03019-15. [Epub ahead of print] PubMed: 26719434

Kong F, et al. Rapid identification and differentiation of Trichophyton species, based on sequence polymorphisms of the ribosomal internal transcribed spacer regions, by rolling-circle amplification. J. Clin. Microbiol. 46: 1192-1199, 2008. PubMed: 18234865

Summerbell RC, et al. rRNA gene internal transcribed spacer 1 and 2 sequences of asexual, anthropophilic dermatophytes related to Trichophyton rubrum. J. Clin. Microbiol. 37: 4005-4011, 1999. PubMed: 10565922

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation