Candida albicans (Robin) Berkhout, anamorph (ATCC® 24433)

Strain Designations: Wasson  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations Wasson
Application
assay of amphotericin B fungizone
quality control
susceptibility testing
Biosafety Level 1
Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Comments
Reference strain for Clinical and Laboratory Standards Institute(CLSI)-developed Antifungal Susceptibility Testing. For additional infromation, see CLSI M27-A2 (Reference Method for Broth Dilution Antifungal Susceptibility Testing of Yeasts; Approved Standards-Second Edition).
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene:

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCGTCTTTGGCGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGCCCGGCTCTTGTCTATGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGACCCGGGTCTGTGTAAAGTTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGCATGCTGCTCTCTCGGGGGCGGCCGCTGCGGTTTACCGGGCCAGCATCGGTTTGGAGCGGCAGGATAATGGCGGAGGAATGTGGCACGGCTTCTGCTGTGTGTTATAGCCTCTGACGATACTGCCAGCCTAGACCGAGGACTGCGGTTTTTACCTAGGATGTTGGCATAATGATCTTAAGTCGC

Name of Depositor ZA McGee
Chain of Custody
ATCC <-- ZA McGee <-- George Hunter Lab
Isolation
Nail infection
References

Brenner DJ, et al. Multisite reproducibility of colorimetric broth microdilution method for antifungal susceptibility testing of yeast isolates. J. Clin. Microbiol. 32: 1625-1628, 1994. PubMed: 7929747

Drutz DJ, et al. Treatment of disseminated mycotic infections. Am. J. Med. 45: 405-418, 1968. PubMed: 5672740

Quality Control of Microbiological Transport Systems; Approved Standard. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M40-A.

Medical microbiology--Susceptibility testing of microbial pathogens to antimicrobial agents -- Part 84: Microdilution; Special requirements for testing of fungi against antifungal agents. Berlin, Germany:Deutsches Institut fur Normung;DIN DIN 58940-84: 2002, 2002

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation