Candida krusei (Castellani) Berkhout, anamorph (ATCC® 14243)

Alternate State: Issatchenkia orientalis Kudrjanzev, teleomorph  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Alternate State Issatchenkia orientalis Kudrjanzev, teleomorph
Application
Quality control strain
Quality control strain for Abbott products
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Comments
RAPD profiles
Morphology On YM medium at 25°C after 3 days, Colonies creamy white to dingy white, smooth becoming wrinkled, margin entire becoming filamentous. Cells hyaline, elongate ovoid, smooth, 5.5-14.5 X 3-4.5 µm. Pseudohyphae present.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACTGTGATTTAGTACTACACTGCGTGAGCGGAACGAAAACAACAACACCTAAAATGTGGAATATAGCATATAGTCGACAAGAGAAATCTACGAAAAACAAACAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAGCGCAGCGAAATGCGATACCTAGTGTGAATTGCAGCCATCGTGAATCATCGAGTTCTTGAACGCACATTGCGCCCCTCGGCATTCCGGGGGGCATGCCTGTTTGAGCGTCGTTTCCATCTTGCGCGTGCGCAGAGTTGGGGGAGCGGAGCGGACGACGTGTAAAGAGCGTCGGAGCTGCGACTCGCCTGAAAGGGAGCGAAGCTGGCCGAGCGAACTAGACTTTTTTTCAGGGACGCTTGGCGGCCGAGAGCGAGTGTTGCGAGACAACAAAAAGCTCGACCTCAAATCAGGTAGGAATA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAGATTTGAAATCGTGCTTTGCGGCACGAGTTGTAGATTGCAGGTTGGAGTCTGTGTGGAAGGCGGTGTCCAAGTCCCTTGGAACAGGGCGCCCAGGAGGGTGAGAGCCCCGTGGGATGCCGGCGGAAGCAGTGAGGCCCTTCTGACGAGTCGAGTTGTTTGGGAATGCAGCTCCAAGCGGGTGGTAAATTCCATCTAAGGCTAAATACTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGCACTTTGAAAAGAGAGTGAAACAGCACGTGAAATTGTTGAAAGGGAAGGGTATTGCGCCCGACATGGGGATTGCGCACCGCTGCCTCTCGTGGGCGGCGCTCTGGGCTTTCCCTGGGCCAGCATCGGTTCTTGCTGCAGGAGAAGGGGTTCTGGAACGTGGCTCTTCGGAGTGTTATAGCCAGGGCCAGATGCTGCGTGCGGGGACCGAGGACTGCGGCCGTGTAGGTCACGGATGCTGGCAGAACGGCGCAACACCG

Morphology On YM medium at 25°C after 3 days, Colonies creamy white to dingy white, smooth becoming wrinkled, margin entire becoming filamentous. Cells hyaline, elongate ovoid, smooth, 5.5-14.5 X 3-4.5 µm. Pseudohyphae present.
Name of Depositor A Castellani
Isolation Not available
References

Zeng S, et al. Random amplified polymorphic DNA analysis of culture collection strains of Candida species. J. Med. Vet. Mycol. 34: 293-297, 1996. PubMed: 8873891

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation