Candida tropicalis (Castellani) Berkhout (ATCC® 13803)

Strain Designations: FDA PCI M-59  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations FDA PCI M-59
Application
Assay of amphotericin B fungizone
Assay of nystatin fungicidin
Control strain for identification
Produces iditol L-iditol
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Medium ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 1245: YEPD
Growth Conditions Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACTGATTTGCTTAATTGCACCACATGTGTTTTTTATTGAACAAATTTCTTTGGTGGCGGGAGCAATCCTACCGCCAGAGGTTATAACTAAACCAAACTTTTTATTTACAGTCAAACTTGATTTATTATTACAATAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATATGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTTGAGCGTCATTTCTCCCTCAAACCCCCGGGTTTGGTGTTGAGCAATACGCTAGGTTTGTTTGAAAGAATTTACGTGGAAACTTATTTTAAGCGACTTAGGTTTATCCAAAAACGCTTATTTTGCTAGTGGCCACCACAATTTATTTCATAACTTTGACCTCAAATCAGGTAGGACTACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCTCTTTCAGAGTCCGAGTTGTAATTTGAAGAAGGTATCTTTGGGTCTGGCTCTTGTCTATGTTTCTTGGAACAGAACGTCACAGAGGGTGAGAATCCCGTGCGATGAGATGATCCAGGCCTATGTAAAGTTCCTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCTTGAGATCAGACTTGGTATTTTGTATGTTACTTCTTCGGGGGTGGCCTCTACAGTTTATCGGGCCAGCATCAGTTTGGGCGGTAGGAGAATTGCGTTGGAATGTGGCACGGCTTCGGTTGTGTGTTATAGCCTTCGTCGATACTGCCAGCCTAGACTGAGGACTGCGGTTTATACCTAGGATGTTGGCATAATGATCTTAAGTCGC

Name of Depositor FDA
Chain of Custody ATCC <-- FDA
Cross References

Nucleotide (GenBank) : AX109696 Sequence 429 from Patent WO0123604.

Nucleotide (GenBank) : AX109742 Sequence 475 from Patent WO0123604.

Nucleotide (GenBank) : AF201686 Candida tropicalis agglutinin-like protein 1 (ALST1) gene, partial

Nucleotide (GenBank) : AF211865 Candida tropicalis strain ATCC 13803 agglutinin-like protein Alst2p

Nucleotide (GenBank) : AF211866 Candida tropicalis strain ATCC 13803 agglutinin-like protein Alst3p

Nucleotide (GenBank) : KU729076 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729171 D1/D2 region of 28S rRNA gene

References

McGinnis MR. Laboratory handbook of medical mycology. New York: Academic Press; 1980.

Ogawa M, et al. Microbial production of optically pure L-iditol by yeast strains. Appl. Environ. Microbiol. 46: 912-916, 1983.

Yilmaz O, Celik S. A combination of alpha-tocopherol, vitamin C and N-acetyl cysteine increases unsaturated fatty acid levels in hydrogen peroxide-induced Candida tropicalis (ATCC 13803). Cell Biochem Funct 21: 269-274, 2003. PubMed: 12910481

Hoyer LL, et al. Characterization of agglutinin-like sequence genes from non-albicans Candida and phylogenetic analysis of the ALS family. Genetics 157: 1555-1567, 2001. PubMed: 11290712

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation