Quantitative Synthetic Hepatitis C virus RNA (ATCC® VR-3233SD)

Product Format: frozen
Specification range: 1 x 105 to 1 x 106 copies/µL
100 µL per vial with Biomatrica RNAstable

Agent Quantitative Synthetic Hepatitis C virus RNA
Applications ATCC® Genuine Nucleics can be used for assay development, verification, validation, monitoring of day to day test variation, and lot to lot performance of molecular-based assays. The quantitative format allows for the generation of a standard curve for quantitative PCR (qPCR) to determine viral load.
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Specification range: 1 x 105 to 1 x 106 copies/µL
100 µL per vial with Biomatrica RNAstable
Storage Conditions -70°C or colder
Intended Use The synthetically engineered sequence of the product constitutes intellectual property belonging to ATCC. Unauthorized use, including sequencing, modification, or reverse-engineering, of the product is expressly prohibited without prior ATCC consent.

Biomatrica Logo
Comments Manufactured under ISO 13485 guidance

Preparation includes fragments from 5’UTR and X-tail region (3’UTR).

The following primers and probe can be used with this nucleic acid preparation RefYoung KK, et al. Detection of hepatitis C virus RNA by a combined reverse transcription-polymerase chain reaction assay. J. Clin. Microbiol. 31(4): 882-886, 1993. PubMed: 8385151:
Forward: GCAGAAAGCGTCTAGCCATGGCGT
Reverse: CTCGCAAGCACCCTATCAGGCAGT
Probe: CATAGTGGTCTGCGGAACCGGTGAGT
Special Collection RNA
References

Lee SC, et al. Improved version 2.0 qualitative and quantitative AMPLICOR reverse transcription-PCR tests for hepatitis C virus RNA: calibration to international units, enhanced genotype reactivity, and performance characteristics. J. Clin. Microbiol. 38(11): 4171-4179, 2000. PubMed: 11060086

Young KK, et al. Detection of hepatitis C virus RNA by a combined reverse transcription-polymerase chain reaction assay. J. Clin. Microbiol. 31(4): 882-886, 1993. PubMed: 8385151