pCDM9 [NEB 848] (ATCC® 69394)

Organism: Arthrobacter luteus Kaneko et al.  /  Clone Type: Clone  /  Depositors: New England Biolabs, Inc., I Schildkraut, New England Biolabs, Inc.

Designations pCDM9 [NEB 848]
Species Arthrobacter luteus Kaneko et al.
Depositors New England Biolabs, Inc., I Schildkraut, New England Biolabs, Inc.
Applications
produces protein modification methylase AluI
produces protein restriction endonuclease AluI
Vector
Construct size (kb): 7.949999809265137
Insert
DNA: genomic
Insert lengths(kb): 1.75
Gene product: modification methylase AluI [aluIM]
Target Gene: modification methylase AluI, restriction endonuclease AluI
Insert Size (kb) 1.75
Media LB + ampicillin (50 mcg/ml) + kanamycin (50 mcg/ml) + chloramphenicol (30 mcg/ml)
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Shipping Information

Shipped:  Freeze dried E. coli containing the plasmids

Comments
Restriction digests of pCDM9 give the following sizes (kb): BamHI--9.4; BamHI/NcoI--7.0, 2.3; PstI--9.4.
Restriction digests of pCDH104 give the following sizes (kb): BamHI--4.6, 1.2, 0.66 (doublet); BamHI/NcoI--2.3 (doublet), 1.2, 0.66 (doublet); PstI--4.6, 3.0.
pCDH104 was constructed from a PCR product amplified using the following primers incorporating, respectively, NcoI and BamHI-EcoRI sites: 5'GAACAGACCATGGGATCAATCGTCGTTGAC3' and 5'GCAATGGATCCGAATTCCTCTGAAGCTTGACAGCTC3'.
References

Xu SY, Nwankwo DO. Method for cloning and producing the AatII and AluI restriction endonuclease and methylase and related method for overexpressing restriction endonuclases. US Patent 5,405,768 dated Apr 11 1995

Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.
Bascic Documentation
U.S. Patent
Disclosure This material is cited in a US or other Patent and may not be used to infringe the claims. Depending on the wishes of the Depositor, ATCC may be required to inform the Patent Depositor of the party to which the material was furnished. This material may not have been produced or characterized by ATCC.