Cryptococcus gattii (Vanbreus. et Takashio) Kwon-Chung et Boekhout, anamorph (ATCC® MYA-4093)

Alternate State: Filobasidiella bacillispora Kwon-Chung, teleomorph  /  Strain Designations: A1M R265  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Cryptococcus bacillisporus
Strain Designations A1M R265
Alternate State Filobasidiella bacillispora Kwon-Chung, teleomorph
Application
Multigene phylogeny and phenotypic characterization.
Biomedical Research and Development Material
Biosafety Level 2
Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Antigenic Properties Serotype B
Genotype VGIIa, AFLP6A
Preceptrol® no
Genome Sequenced Strain

Yes

Mating Type MATalpha
Comments
Genome sequencing strain (Broad Institute, USA).
Cause cryptococcosis; the strain represents 'type strain' for one of the two genotypes causing outbreak on Vancouver Island. Molecular type VGIIa.
Multigene phylogeny and phenotypic characterization.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
Growth Conditions
Temperature: 25°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence:

AAGGATCAGTAGAGAATACTGGACTTCGGTCCATTTATCTACCCATCTACACCTGTGAACTGTTTATGTGCTTCGGCACGTTTTACACAAACTTCTAAATGTAATGAATGTAATCTTATTATAACAATAATAAAACTTTCAACAACGGATCTCTTGGCTTCCACATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCAACTTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTTGAGAGTCATGAAAATCTCAATCCCTCAGGTTTTATTACCTGTTGGACTTGGATTTGGGTGTTTGCCGCGACCTGCAAAGGACGTCGGCTCGCCTTAAATGTGTTAGTGGGAAGGTGATTACCTGTCAGCCCGGCGTAATAAGTTTCGCTGGGCCTATGGGGTAGTCTTCGGCTTGCTGATAACAACCATCTCTTTTTGTTTGACCTCAAATCAGGTAGGGCTACCCGCTGAACTTAA


D1D2 region of the 28S ribosomal RNA gene:

ATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCTTAGTAACGGCGAGTGAACCGGGAAGAGCTCAAATTTGAAATCTGGCGTCCTCCGGGCGTCCGAGTTGTAATCTACAGAAACGTTTTCCGTGCTGGACCGTGTCTAAGTCCCTTGGAATAGGGTATCAAAGAGGGTGACAATCCCGTACTTGACACGATCACCAGTGCTCTGTGATACGTTTTCTACGAGTCGCGTTACTTGGGAGTGTAGCGCAAAATGGGTGGTAAACTCCATCTAAAGCTAAATATTGGTGGAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGATTGAAGTCAGTCGTGTCTATTGGGTTCAGCCAGTTCTGCTGGTGTATTCCCTTTAGACGGGTCAACATCAGTTCTGATCGGTGGATAAGGGCTGGAGGAATGTGGCACTCTTCGGGGTGTGTTATAGCCTCCTGTCGCATACACTGGTTGGGACTGAGGAATGCAGCTCGCCTTTATGGCCGGGGTTCGCCCACGTTCGAGCTTAGGATGTTGACAAAATGGCTTTAAACGA

Name of Depositor L Hoang
Special Collection NSF - Mycology
Chain of Custody
ATCC <-- L. Hoang
Isolation
Bronchial alveolar lavage, Duncan, Vancouver Island, B.C. Canada.
Cross References

Complete Genome (GenBank) : AAFP00000000 Cryptococcus bacillisporus R265, whole genome shotgun sequencing project

References

Guanggan Hu, Kronstad James W.. Gene disruption in Cryptococcus neoformans and Cryptococcus gattii by in vitro transposition. Curr. Genet. 49: 341-350, 2006.

Fraser James A, et al. Same-sex mating and the origin of the Vancouver Island Cryptococcus gattii outbreak. Nature 437: 1360-1364, 2005.

Kidd Sarah E, et al. Comparative gene genealogies indicate that two clonal lineages of Cryptococcus gattii in British Columbia resemble strains from other geographical areas. Eukaryot. Cell 4: 1629-1638, 2005.

Kidd Sarah E, et al. A rare genotype of Cryptococcus gattii caused the cryptococcosis outbreak on Vancouver Island (British Columbia, Canada). Proc. Natl. Acad. Sci. USA 101: 17258-17263, 2004.

Findley K, et al. Phylogeny and phenotypic characterization of pathogenic Cryptococcus species and closely related saprobic taxa in the Tremellales. Eukaryot. Cell 8: 353-361, 2009.

Wang H, et al. A fungal phylogeny based on 82 complete genomes using the composition vector method. BMC Evol. Biol. 9: 195, 2009.

Meyer W. et al. Consensus multi-locus sequence typing scheme for Cryptococcus neoformans and Cryptococcus gattii. Med. Mycol. 47(6):561-570, 2009. PubMed: 19462334

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation