Hamigera insecticola Peterson et al. (ATCC® MYA-3630)

Strain Designations: 10831220  /  Product Format: frozen

Permits and Restrictions

View Permits

Deposited As Paecilomyces variotii Bainier
Strain Designations 10831220
Application
Antifungal susceptibility testing
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Comments Human pathogen

The strain was re-identified as Hamigera insecticola based on the multigene sequence analysis. This change does not affect to its use as quality control strain for standard tests.
Morphology Colonies growing rapidly, powdery to floccose, funiculose or tufted, yellow-brown or sand colour. Conidiophores with verticillately arranged branches, bearing phialides, up to 150 µm in length, 3.5-6.5 µm wide. Phialides cylindrical or ellipsoidal, tapering abruptly into a long, thin, cylindrical neck. Conidia subspherical, ellipsoidal to fusiform, hyaline to yellow, 3-5 x 2-4 µm, arising in long, divergent chains. Chlamydospores usually present.
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACCGAGTGCGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATCGTACCTTGTTGCTTCGGCGGGCCCGCCGTCAGGCCGCCGGGGGGCGTCTCGCCCCCGGGCCCGCGCCCGCCGAAGACACCATCGAACGCTGTCTGAAGGTTGCCGTCTGAGTCGATTATCAAATCGTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTGCTGCCCTCAAGCCCGGCTTGTGTGTTGGGTCGCCGTCCCCCCGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTCGTCACCCGCTCTGCAGGCCCGGCCGGCGCTGGCCGACAACCTTTTTTACTTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGCCCCTCCGGGGTCCGAGTTGTAATTTGCAGAGGATGCTTCGGATACGGCCCCCGTCTAAGTGCCCTGGAACGGGCCGTCGGAGAGGGTGAGAATCCCGTCTGGGACGGGGTGTCCGTGTCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCCGACGGGGTTCAGCCGGGATTCGTCCCGGTGTACTTCCCCGCCGGCGGGCCAGCGTCGGTTTGGGCGGCCGGTCAAAGGCCTCCGGAATGTATCGCCCCCCGGGGCGTCTTATAGCCGGAGGTGCAATGCGGCCTGCCCGGACCGAGGAACGCGCTTCGGCACGGACGCTGGCATAATGGTCGTAAGCGAC


beta-tubulin (TUB2) gene

GAGATTGTAAGTTGTCCCCTCAAACAGACGCGTTTCTGCTTTTGCCTGGGTTCTCCCCTGAGAGAGACCCCACCCGTTCAAACAACGCAGACTTGCTGACTTTACTTCGACTACAGGTTCACCTCCAGACCGGCCAGTGTGTAAGTTTGATTTTTTTCGACATGGGATCTTTGAAGGGAGTATTTGTGATTGGCAAGAATACTAAAATCCGATCTCTGGCATAGGGTAATCAAATAGGTGCTGCTTTCTGGTACGTTGACAAATCCAAACGAGAAGACAAAATAAAATCCCAACTTCTCAAAACACCAATTCAATAGAAATTGGGTCGAATAATATCATACTGACAATCTTTACAGGCAGACCATCTCTGGCGAGCACGGTCTTGATGGCTCCGGTGTGTAAGTGCAACCCACGCTTTCGGCCCCGACAACGATACAACCAGATCAATTCTGATGATAAAACAGTTACAATGGCACCTCCGACCTCCAGTTGGAGCGTATGAACGTTTACTTCAACGAGGTTCGTGAATTGGACATGTGGATCCGAATACAACGTGTCCAATGCTGATATATCATCAGGCCAGCGGTAACAAGTATGTCCCCCGTGCCGTCTTGGTCGATCTCGAGCCTGGCACCATGGACGCTGTCCGTGCCGGTCCTTTCGGCCAGCTCTTCCGCCCCGACAACTTCGTTTTCGGCCAGTCTGGTGCCGGTAACAACTGGGCCAAGGGTCACT

Morphology Colonies growing rapidly, powdery to floccose, funiculose or tufted, yellow-brown or sand colour. Conidiophores with verticillately arranged branches, bearing phialides, up to 150 µm in length, 3.5-6.5 µm wide. Phialides cylindrical or ellipsoidal, tapering abruptly into a long, thin, cylindrical neck. Conidia subspherical, ellipsoidal to fusiform, hyaline to yellow, 3-5 x 2-4 µm, arising in long, divergent chains. Chlamydospores usually present.
Name of Depositor MG Rinaldi
Special Collection NSF - Mycology
Chain of Custody
ATCC <-- MG Rinaldi
Isolation
Connecticut, United States
Geographical Isolation Hartford Hospital
Cross References

Nucleotide (GenBank) : KU933444 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU933420 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KU896997 beta-tubulin (TUB2) gene

References

Reference Method for Broth Dilution Antifungal Susceptibility Testing of Filamentous Fungi: Approved Standard - 2nd Edition. Wayne, PA. Clinical and Laboratory Standards Institute; CLSI M38-A2.

Espinel-Ingroff A, et al. Quality control and reference guidelines for CLSI broth microdilution susceptibility method (M38-A document) for amphotericin B, itraconazole, posaconazole, and voriconazole. J. Clin. Microbiol. 43: 5243-5246, 2005.

Ghannoum MA, et al. Interlaboratory study of quality control isolates for a broth microdilution method (modified CLSI M38-A) for testing susceptibilities of dermatophytes to antifungals. J. Clin. Microbiol. 44: 4353-4356, 2006.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation
Other Documentation