Penicillium rubens Biourge (ATCC® 9179)

Strain Designations: NRRL 832 [ATCC 7813, B 69, CBS 197.46, IMI 17968, QM 940]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Penicillium notatum Westling, anamorph
Strain Designations NRRL 832 [ATCC 7813, B 69, CBS 197.46, IMI 17968, QM 940]
Application
produces penicillin
produces phosphogluconate dehydrogenase 6-phosphogluconate dehydrogenase
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Comments Prototype strain for production of penicillin in submerged culture

The strain was reclassified as Penicillium rubens based on a recent molecular phylogenetic study RefHoubraken J, et al. New penicillin-producing Penicillium species and an overview of section Chrysogena. Persoonia 29: 78-100, 2012. PubMed: 23606767
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

GGTTTCCGTAGGTGAACCTGCGGAAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTTACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAA


Beta-tubulin (TUB2) gene, partial sequence

GATCCCCTCCAGACGCGTCTTTTGTTTTCATATGGCCCCTGAGCCACGACCCCACCCCCAACAGATCTTTTGCTAACTTGCTCTAGGTTCACCTCCAAACCGGCCAGTGTGTAAGTTCAACATGGAACATTCTTGGAAACATTCTTCGATTCGTGGGACTAAACTGGAATTGGGTTATAGGGTAACCAAATTGGTGCCGCTTTCTGGTAAGTCTCGGAGCTTTTTTTTTCGCGTTGGGTATCAATTGACAAGTTGCTAACTGGATTACAGGCAAACCATCTCTGGCGAGCACGGTCTCGATGGCGATGGACAGTAAGTTTAACAGTGATAGGGATTCTGGTGGATCACACGTCTGATATCTTGCTAGGTACAATGGTACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGACTGGGAATCGATTGATTGTGCATCATCTGATCGGACGTTTTTCTTTGACAATCTAGGCCAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCCCGGTACCATGGATGCTGTCCGCTCCGGTCCCTTCGGCAAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCACT

Name of Depositor NRRL
Chain of Custody
ATCC <-- NRRL <-- C Thom B 69
Isolation
Contaminant in culture labeled 'P. lacticus Maze & Perrier' from Ph. Biourge 69, Washington, DC
References

Houbraken J, et al. New penicillin-producing Penicillium species and an overview of section Chrysogena. Persoonia 29: 78-100, 2012. PubMed: 23606767

Miller HM, Shepherd MG. Purification and properties of 6-phosphogluconate dehydrogenase from Penicillium duponti and Penicillium notatum. Can. J. Microbiol. 18: 1289-1298, 1972. PubMed: 5052896

Moyer AJ, Coghill RD. Penicillin. IX. The laboratory scale production of penicillin in submerged cultures by Penicillium notatum Westling (NRRL 832). J. Bacteriol. 51: 79-93, 1946.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation