Alternaria alternata (Fries) Keissler (ATCC® 6663)

Product Format: freeze-dried

Deposited As Alternaria tenuis Nees
Application
produces ALT-I
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Comments
Allergenic fraction (ALT-I)
Medium ATCC® Medium 343: V8 juice agar
ATCC® Medium 336: Potato dextrose agar (PDA)
ATCC® Medium 340: Rabbit food agar
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence 

GGTCTCCGTAGGTGAACCTGCGGAGGGATCATTACACAAATATGAAGGCGGGCTGGAACCTCTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGCGTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAACATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATAATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTGCTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCTTAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACAAGTCGCACTCTCTATCAGCAAAGGTCTAGCATCCATTAAGCCTTTTTTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAA


D1D2 region of the 28S ribosomal RNA gene 

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTTTTAGAGTCCGAGTTGTAATTTGCAGAGGGCGCTTTGGCTTTGGCAGCGGTCCAAGTTCCTTGGAACAGGACGTCACAGAGGGTGAGAATCCCGTACGTGGTCGCTGGCTATTGCCGTGTAAAGCCCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGAGGTACATTTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTCAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCAGCCAGACTTGCTTACAGTTGCTCATCCGGGTTTCTACCCGGTGCACTCTTCTGTAGGCAGGCCAGCATCAGTTTGGGCGGTAGGATAAAGGTCTCTGTCACGTACCTCCTTTCGGGGAGGCCTTATAGGGGAGACGACATACTACCAGCCTGGACTGAGGTCCGCGCATCTGCTAGGATGCTGGCGTAATGGCTGTAAGCGG


Elongation factor 1-alpha gene (EF) 

TCATTGCCGCCGGTACTGGTGAGTTCGAGGCTGGTATCTCCAAGGATGGCCAGACTCGTGAGCACGCTCTCCTCGCTTACACCCTCGGTGTCAAGCAGCTCATCGTTGCCATCAACAAGATGGACACCACCAAGTGGTCCGAGGAGCGTTACCAGGAGATCATCAAGGAGACCTCCAACTTCATCAAGAAGGTCGGCTACAACCCCAAGCACGTTCCCTTCGTCCCCATCTCCGGTTTCAACGGTGACAACATGATTGAGGCCTCATCCAACTGCCCCTGGTACAAGGGTTGGGAGAAGGAGACCAAGGCCAAGGCCACTGGTAAGACCCTCCTCGAGGCCATCGACGCCATCGACCCTCCCAGCCGTCCCACCGACAAGCCCCTCCGTCTTCCCCTCCAGGATGTTTACAAGATTGGTGGTATTGGCACGGTGCCCGTCGGTCGTGTCGAGACCGGTATCATCAAGGCCGGTATGGTCGTCACCTTCGCCCCCGCTGGTGTCACCACTGAAGTCAAGTCCGTCGAGATGCACCACGAGCAGCTCACCGAGGGTGTCCCCGGTGACAACGTCGGCTTCAACGTCAAGAACGTCTCCGTCAAGGAGATCCGTCGTGGTAACGTTGCCGGTGACTCCAAGAACGACCCCCCCAAGGGTGCCGAGTCCTTCAACGCCCAGGTCATCGTCCTCAACCACCCTGGTCAGGTCGGTGCTGGTTACGCCCCAGTCCTCGACTGCCACACCGCCCACATTGCTTGCAAGTTCTCTGAGCTCCTCGAGAAGATTGACCGCCGTACCGGAAAGTCTGTTGAGAACTCTCCCAAGTTCATCAAGTCCGGTGACGCCGCCATCGTCAAGATGGTTCCCTCCAAGCCCATGTGCGTTGAGGCTTTCAC


RNA polymerase II second largest subunit gene (RPB2)

TAAGAAGCGTCTAGATCTTGCAGGACCCTTGGTCGCCAACTTGTTCCGTATCCTCTTCCTGAAGCTCACCAAGGACGTATACAAGTACCTCCAGCGATGTGTTGAGAACAACCAGGACTTCAACGTTCAGATGGCTGTCAAGGCCAGCATCATCACAAACGGCCTGAAATACTCCCTGGCAACAGGAAATTGGGGTGACCAGAAGAAGGCCGCTTCCGCGAAAGCCGGTGTCTCTCAGGTGTTGAACCGATACACTTACGCCTCCACACTGTCCCATTTGCGTCGAACAAATACCCCTGTTGGTCGTGATGGAAAGCTGGCCAAGCCGCGACAACTCCACAACTCTCATTGGGGTCTTGTCTGCCCTGCCGAGACTCCTGAAGGACAGGCATGTGGTCTGGTTAAGAACCTGTCTTTGATGTGCTATGTTAGTGTCGGTAGTGACGCTTCTCCCATCATCGACTTCATGACACAACGAAACATGCAACTTCTAGAAGAGTATGATCAGAACCAGAACCCCGATGCCACCAAGGTCTTCGTCAACGGTGTCTGGGTTGGTGTCCATTCCAACGCTCAACAACTTGTCACAGTTGTGCAGGAGCTGCGACGAAACGGAACTCTATCCTATGAGATGAGTCTGATTCGTGACATTCGTGACCGAGAGTTCAAGATCTTCACAGATGCTGGTCGTGTCATGAGACCACTGTTCGTTGTTGAGAACGACATCCGGAAGCCAAACCGCAATCACCTCATCTTCACCAAGGAGATCAGTAACAAGCTCAAGCAGGAGCAACAAGAGACAAGCACACGACAGGGTTGGAGCCAGGATGAGGTCGAGTCAGCTACCTACGGCTGGAGAGGTCTTATTCAAGACGGTGTTGTGGAGTACCTAGACGCTGAAGAGGAGGAGACCGCCATGATAACGTTCTCCCCTGAGGATCTGGAGGAGTGGCGAGAGATGAAATTGGGCTTGCCGGCGGCTGAGCGATCCACCGAGGGTGAGCACCGTCTCCGACGCCTCAAGCCACTACCAGACCCCCGCATCCATGCCTATACTCATTGCGAGATTCATCCTGCTATGATTCTCGGTATCTGTGCCAGTATTATTCCCTTCCCCGATCACAACCAATCGCCCCGTAACACTTACCAATCTGCT

Name of Depositor JE Machacek
Chain of Custody
ATCC <-- JE Machacek <-- CBS
Cross References

Nucleotide (GenBank) : KU729030 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : KU729114 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : KU933426 elongation factor (EF) 1-alpha gene

Nucleotide (GenBank) : KU933459 RNA polymerase II second largest subunit (RPB2) gene

References

Yunginger JW, et al. Studies on Alternaria allergens. III. Isolation of a major allergenic fraction (ALT-1). J Allergy Clin Immunol 66: 138-147, 1980. PubMed: 7190582