Rhizopus stolonifer (Ehrenberg : Fries) Lind (ATCC® 14037)

Strain Designations: UNB-1 [IMI 90609, VKM F-402]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Strain Designations UNB-1 [IMI 90609, VKM F-402]
Application
Produces polygalacturonase endopolygalacturonase, pectinase
Produces kynureninase-type enzymes
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Mating Type plus tester mating type
Comments
Zygospore germination
Sequenced Data
D1D2 region of the 28S ribosomal RNA gene

ATATCAATAAGCGGAGGAAAAGAAAATAACAATGATTTCCCTAGTAACGGCGAGTGAAGAGGAAAGAGCTCAAAGTTGGAACCTGTTTGGCCTAGCTAAACAGGATTGTAAACTGTAGAAGTGTTTTCCAGGCAATCCGAGTTAATAAGTCCTTTGGAACAGGGCATCATAGAGGGTGAGAATCCCGTCTTTGATTCGAGATATTTTGTCTTTTGCGATACACTTTCAAAGAGTCAGGTTGTTTGGGAATGCAGCCTAAATTGGGTGGTAAATCTCACCTAAAGCTAAATATTGGCGAGAAACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGAACTTTGAAAAGAGAGTTAAACAGTATGTGAAATTGTTAAAAGGGAACCGTTTGGAGCCAGACTGGCTTGTCTGTAATCAATCTAGGTTTCGTGCCTGGATGCACTTGCAGACTATTTGCCTGCCAACGACAATTTTTTTTGAGTGTAAAAACTATTGGAAATGTGGCCAATATTTATTTATTGGTGTTATAGTCCTTTAGAAAATACCTTGAATTGGATTGAGGAACGCAGCGAATGCTTCTCTTTTGAGGCAAAGTCTTTTATTGGGATTTACGGATCAGACTGTGGCATTGTCACAAGACTTGAAGTTTAAACCTATTTTTGAACTTTTATTCGCTTAGGTTGTTGGCTTAATGACTCTAAATGAC

Name of Depositor WL Gauger
Chain of Custody ATCC <-- WL Gauger
Cross References

Nucleotide (GenBank) : L47267 Rhizopus stolonifer beta-tubulin gene, partial cds.

Nucleotide (GenBank) : AF117935 Rhizopus stolonifer ATCC 14037 5.8S ribosomal RNA gene, partial

Nucleotide (GenBank) : KU729185 D1/D2 region of 28S rRNA gene

References

Am. J. Bot. 48: 427-429, 1961.

Shetty AS, Gaertner FH. Kynureninase-type enzymes of Penicillium roqueforti, Aspergillus niger, Rhizpus stolonifer, and Pseudomonas fluorescens: Further evidence for distinct kynureninase and hydroxykynureninase activities. J. Bacteriol. 122: 235-244, 1975. PubMed: 164432

Trescott AS, Tampion J. Properties of the endopolygalacturonase secreted by Rhizopus stolonifer. J. Gen. Microbiol. 80: 401-409, 1974.

Choi JS, Westerman JM, Morrison CJ. Rapid differentiation of filamentous fungi using species-specific DNA probes. Abstr Gen Meet Am Soc Microbiol 98, C288-C298, 1998.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation