Penicillium rubens Biourge (ATCC® 10002)

Strain Designations: [CBS 277.47, IFO 4626, IMI 37767, PRL 1910, QM 943, Wis. Q-176]  /  Product Format: freeze-dried

Permits and Restrictions

View Permits

Deposited As Penicillium chrysogenum Thom
Strain Designations [CBS 277.47, IFO 4626, IMI 37767, PRL 1910, QM 943, Wis. Q-176]
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® yes
Comments This strain was re-identified as Penicillium rubens based on the multigene sequence analysis
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AAGGATCATTACCGAGTGAGGGCCCTCTGGGTCCAACCTCCCACCCGTGTTTATTTTACCTTGTTGCTTCGGCGGGCCCGCCTTAACTGGCCGCCGGGGGGCTTACGCCCCCGGGCCCGCGCCCGCCGAAGACACCCTCGAACTCTGTCTGAAGATTGTAGTCTGAGTGAAAATATAAATTATTTAAAACTTTCAACAACGGATCTCTTGGTTCCGGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAAATTCAGTGAATCATCGAGTCTTTGAACGCACATTGCGCCCCCTGGTATTCCGGGGGGCATGCCTGTCCGAGCGTCATTTCTGCCCTCAAGCACGGCTTGTGTGTTGGGCCCCGTCCTCCGATCCCGGGGGACGGGCCCGAAAGGCAGCGGCGGCACCGCGTCCGGTCCTCGAGCGTATGGGGCTTTGTCACCCGCTCTGTAGGCCCGGCCGGCGCTTGCCGATCAACCCAAATTTTTATCCAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAAGCTGGCTCCTTCGGGGTCCGCATTGTAATTTGTAGAGGATGCTTCGGGAGCGGTCCCCATCTAAGTGCCCTGGAACGGGACGTCATAGAGGGTGAGAATCCCGTATGGGATGGGGTGTCCGCGCCCGTGTGAAGCTCCTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAATGGGTGGTAAATTTCATCTAAAGCTAAATATTGGCCGGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGCGACCAGACTCGCTCGCGGGGTTCAGCCGGCATTCGTGCCGGTGTACTTCCCCGCGGGCGGGCCAGCGTCGGTTTGGGCGGTCGGTCAAAGGCCCTCGGAAGGTAACGCCCCTAGGGGCGTCTTATAGCCGAGGGTGCAATGCGACCTGCCTAGACCGAGGAACGCGCTTCGGCTCGGACGCTGGCATAATGGTCGTAAACGA


Beta-tubulin (TUB2) gene, partial sequence

TTGTAAGTGATCCCCTCCAGACGCGTCTTTTGTTTTCATATGGCCCCTGAGCCACGACCCCACCCCCAACAGATCTTTTGCTAACTTGCTCTAGGTTCACCTCCAAACCGGCCAGTGTGTAAGTTCAACATGGAACATTCTTGGAAACATTCTTCGATTCGTGGGACTAAACTGGAATTGGGTTATAGGGTAACCAAATTGGTGCCGCTTTCTGGTAAGTCTCGGAGCTTTTTTTTTCGCGTTGGGTATCAATTGACAAGTTGCTAACTGGATTACAGGCAAACCATCTCTGGCGAGCACGGTCTCGATGGCGATGGACAGTAAGTTTAACAGTGATAGGGATTCTGGTGGATCACACGTCTGATATCTTGCTAGGTACAATGGTACCTCCGACCTCCAGCTCGAGCGTATGAACGTCTACTTCAACCATGTGAGTACAATGACTGGGAATCGATTGATTGTGCATCATCTGATCGGACGTTTTTCTTTGACAATCTAGGCCAGCGGTGACAAGTACGTTCCCCGTGCCGTTCTGGTCGATTTGGAGCCCGGTACCATGGATGCTGTCCGCTCCGGTCCCTTCGGCAAGCTTTTCCGCCCCGACAACTTCGTCTTCGGTCAGTCCGGTGCTGGTAACAACTGGGCCAAGGGTCA

Name of Depositor KB Raper
Chain of Custody
ATCC <-- KB Raper <-- M.P. Backus et al. Wis. Q-176
References

Backus MP, et al. Penicillin yields from new mold strains. J. Am. Chem. Soc. 68: 152-153, 1946.

Yamada K, et al. Continuous gallic acid production from tara-tannin with an immobilized fungi bioreactor. Ann. N.Y. Acad. Sci. 542: 371-374, 1987.

Theriault RJ. Mycarosyl macrolide antibiotics. US Patent 3,784,447 dated Jan 8 1974

Sutherland ES, et al. Production of double stranded ribonucleic acid. US Patent 3,597,318 dated Aug 3 1971

Storm AM, Gasner LL. Treatment of pulp mill wastes. US Patent 3,737,374 dated Jun 5 1973

Crosse R, Mason PJ. Virus-like particles in Penicillium chrysogenum. Trans. Br. Mycol. Soc. 62: 603-610, 1974.

Clark AM, Hufford CD. Microbial transformations of the sesquiterpene lactone costunolide. J. Chem. Soc. Perkin Trans. 1979: 3022-3028, 1979.

Isobe K, et al. Differential determination procedure for putrescine, spermidine and spermine with polyamine oxidase from fungi and putrescine oxidase. Agric. Biol. Chem. 45: 727-733, 1981.

Yamada H, et al. Oxidation of polyamines by fungal enzymes. Agric. Biol. Chem. 44: 2469-2476, 1980.

Microbial assay for antibiotics. Tokyo, Japan:Japanese Pharmacopoeia;JP JP14e.part I.34.

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation