Lachancea dasiensis Lee (ATCC® MYA-4748)

Strain Designations: SC5L02 [CBS 10888, BCRC 23139]  /  Product Format: frozen

Permits and Restrictions

View Permits

Strain Designations SC5L02 [CBS 10888, BCRC 23139]
Application
Ferments galactose and maltose
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain yes
Preceptrol® no
Genome Sequenced Strain

Yes

Comments Genome sequencing strain (Institut Micalis, France)
Morphology On YEPD at 25°C for 3 days, colonies white to creamy white, butyrous, smooth, glistening, margin entire. On YM at 25°C for 12 days, cells globose to ovoidal, 5.25-7.5 µm x 4.5-5.25 µm.
Medium ATCC® Medium 28: Emmons' modification of Sabouraud's agar
ATCC® Medium 200: YM agar or YM broth
ATCC® Medium 1245: YEPD
Growth Conditions
Temperature: 24°C to 26°C
Atmosphere: Typical aerobic
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal   transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence.

CTGCGGAAGGATCATTAAAGAAATTTGTTAGAGCAGCCGGGAAAGCTTGGATGCCTGCGCTTGATTGCGCGGCTGACGATGCTTTCTGTTAACGACTGTCTCTTCTACACACACACTGTGGAGTAATTTATTTACAACGCTTCTTCTTTGGGCTTCGGCCCAAGGGTTACAAACACAAACAACTTTTGTATTTTAAACATTGTCAATTATTTTTCATTTTAGAAAAAAATATTTAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTATTGTGAATTGCAGATATTCGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCAGGGGGCATGCCTGTTTGAGCGTCATTTCCTTCTCAAACCTTAGGGTTTGGTAGTGAGTGGTACTCTTTCTGGGTTAACTTGAAAATGCTGGCCATCTGGCTGTTGCTGACTGAGACTTTAGTCCAGTCTGCTGATACTCTGCGTATTAGGTTTTACCAACTCGTAGTGGCGTTAGTAGGCGTTACAAAGACTTTTGTCAAAAGTACGGACAGCCTGGCAAACAGTATTCACAAAGTTTGACCTCAAATCAG


D1D2 region of the 28S ribosomal RNA gene

TTAAGCATATCAATAAGCGGAGGAAAAGAAACCAACCGGGATTGCCTTAGTAACGGCGAGTGAAGCGGCAAAAGCTCAAATTTGAAATCTGGCACCTTCGGTGTCCGAGTTGTAATTTGAAGAAGCAACTTTGGGGCTAGTCCTTGTCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTTTGGCGAGGAGTCTAGTCCTATGTAAAGTGCTTTCGACGAGTCGAGTTGTTTGGGAATGCAGCTCTAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACAGTGATGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGCATTTGATCAGACATGGTGTTTTGCGACCCTCGCTCCTTGTGGGTGGGGATCTCGCAGTTCACTGGGCCAACATCAGTTTTGGCGGCAGGATAAATCTTTGGGAATGTGGCTTTTCTTCGGAGAAGCGTTATAGACCAGGGGAATACTGCCAGCCGGGACTGAGGACTGCGACTTTTGTCAAGGATGTTGGCATAATGGTTATATGCCGCCCGTCTT

Morphology On YEPD at 25°C for 3 days, colonies white to creamy white, butyrous, smooth, glistening, margin entire. On YM at 25°C for 12 days, cells globose to ovoidal, 5.25-7.5 µm x 4.5-5.25 µm.
Name of Depositor CF Lee
Special Collection ATCC
Chain of Custody
ATCC <-- CF Lee
Isolation
Leaf of Angiopteris lygodiifolia in Dasi, Taoyuan, Taiwan.
Cross References

Nucleotide (GenBank) : HQ999954 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : HQ999976 ITS including 5.8S rRNA gene

Nucleotide (GenBank) : FJUP00000000 Lachancea dasiensis CBS 10888, whole genome shotgun sequencing project

References

Lee CF, et al. Lachancea dasiensis sp. nov., an ascosporogenous yeast isolated from soil and leaves in Taiwan. Int J Syst Evol Microbiol 59: 1818-1822, 2009. PubMed: 19542139

Notice: Necessary PermitsPermits

These permits may be required for shipping this product:

  • Customers located in the state of Hawaii will need to contact the Hawaii Department of Agriculture to determine if an Import Permit is required. A copy of the permit or documentation that a permit is not required must be sent to ATCC in advance of shipment.
Basic Documentation