Saagaromyces sp. (ATCC® MYA-3874)

Strain Designations: M208  /  Product Format: frozen

Strain Designations M208
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Medium ATCC® Medium 790: By+ medium
Growth Conditions
Temperature: 25.0°C
Sequenced Data
>ITS DNA sequence for MYA-3874

CAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTCATGACTCCAAACCCACTGTGAACCTACCCGACGCCTCGGCGGGCGGGCCCCTGGGGGGGCCCGCAGGCGCAAGCCGCCCGCCGCAGGACAGACTCTCACAGGGCGAAATACCTTCTGAGTGGTACTAAAAACAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCGGCACTCCGGCGGGCATGCCTGTTCGAGCGTCATCTCAAACCCCTCAGGCCACGCCTGGTGCTGGGGGCCCGCGACCCGTAGCGGCCGCGGCCCCTAAAATACAGCGGCGGCACGCCCCGGCGCCCCCTGCGAAGTCGCTAAACCTCGCTTCGGGCCGCCCCGGCGCCAGCCACCCCAAGACGAGGCGCCGCCGCGCGCGGCAGCCCGCTGGTTTGACCTCGGATCAGGTAG

>D1D2 DNA sequence for MYA-3874

TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGAGGCGCCTTCCGAGTGCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTACGGCCGGCCGCCGAGCCTCTGTGAAGCTCCTTCGAAGAGTCGAGTAGTTTGGGAATGCTGCTCTAAGCGGGAGGTATACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACCTGCGCCCGGCGGCTCAGCTGGCGTTCTCGCCAGTGCACTCCGCCGGCTCAGGCCAGCATCGGTTCGCCGCTGGGGAGAACGGCGGCGGGAATGTGGCTCTTCGGAGTGTTATAGCCCGCCGCCATGCCCTCCGGCGGACCGAGGTTCGCGCACCGCAAG

Name of Depositor HP Molitoris
Special Collection ATCC
Chain of Custody
ATCC <-- HP Molitoris
References

Rohrmann S, Molitoris P. Screening for wood degrading enzymes in marine fungi. Can. J. Bot. 70: 2116-2123, 1992.