Saagaromyces sp. (ATCC® MYA-3874)

Strain Designations: M208  /  Product Format: frozen

Strain Designations M208
Biosafety Level 1
Product Format frozen
Type Strain no
Preceptrol® no
Medium ATCC® Medium 790: By+ medium
Growth Conditions
Temperature: 25.0°C
Sequenced Data
>ITS DNA sequence for MYA-3874

CAAGGTCTCCGTTGGTGAACCAGCGGAGGGATCATTACCGAGTTCATGACTCCAAACCCACTGTGAACCTACCCGACGCCTCGGCGGGCGGGCCCCTGGGGGGGCCCGCAGGCGCAAGCCGCCCGCCGCAGGACAGACTCTCACAGGGCGAAATACCTTCTGAGTGGTACTAAAAACAAGTCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCGGCACTCCGGCGGGCATGCCTGTTCGAGCGTCATCTCAAACCCCTCAGGCCACGCCTGGTGCTGGGGGCCCGCGACCCGTAGCGGCCGCGGCCCCTAAAATACAGCGGCGGCACGCCCCGGCGCCCCCTGCGAAGTCGCTAAACCTCGCTTCGGGCCGCCCCGGCGCCAGCCACCCCAAGACGAGGCGCCGCCGCGCGCGGCAGCCCGCTGGTTTGACCTCGGATCAGGTAG

>D1D2 DNA sequence for MYA-3874

TTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCGGCCCGAGTTGTAATTTGCAGAGGATGCTTCTGGCGAGGCGCCTTCCGAGTGCCCTGGAACGGGACGCCGCAGAGGGTGAGAGCCCCGTACGGCCGGCCGCCGAGCCTCTGTGAAGCTCCTTCGAAGAGTCGAGTAGTTTGGGAATGCTGCTCTAAGCGGGAGGTATACCCCTTCTAAAGCTAAATACCGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACCTGCGCCCGGCGGCTCAGCTGGCGTTCTCGCCAGTGCACTCCGCCGGCTCAGGCCAGCATCGGTTCGCCGCTGGGGAGAACGGCGGCGGGAATGTGGCTCTTCGGAGTGTTATAGCCCGCCGCCATGCCCTCCGGCGGACCGAGGTTCGCGCACCGCAAG

Name of Depositor HP Molitoris
Special Collection ATCC
Chain of Custody
ATCC <-- HP Molitoris
References

Rohrmann S, Molitoris P. Screening for wood degrading enzymes in marine fungi. Can. J. Bot. 70: 2116-2123, 1992.