Remispora trullifera Kohlm. (ATCC® MYA-3864)

Strain Designations: M194  /  Product Format: frozen

Deposited As Halosarpheia trullifera (Kohlm.) Jones et al.
Strain Designations M194
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Medium ATCC® Medium 790: By+ medium
Growth Conditions
Temperature: 20.0-25.0°C
Sequenced Data
>ITS DNA sequence for MYA-3864

ATCATTAGCGAGTTATTACCAACTCCAAACCCTTGCGAATCGTTGGAAGCCTGTATACTTGCCGGTGCTACCTAATTTCGGCGGGTGTGGGGGTTCCGCGGACACCTGTCCCGGTTCCCTCCCGGGAAACCAGCCCGCCGGAAGCGCCAAAACACTACGTATCTTATTGGCGTTTTTTTTATCCACTGAGTGGTGTAATGAAGAAGTTACAAAACAAAACAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGGAGCGAAATCCGATAAGTAATGCGAATTGCAGATTTCAGCGAGTCATCGAATCTTTGAACGCACATTGCACCCGGTGGTATTCCGCCGGGTATGCCTGTTCGAGCGTCATTTCAACCCTCAGGCCCACCCGCCCGTCAAGGCGTGGGAGAATAGGCCTGGTGTTGGGGCGCTGCAGCCCTATGATGGGCTGCAGGCTCCGAAAACTAGTGGCGCACCTGCCGGCGGTAGCCCCTGCGTAGTAGAACTTTCAACCTCGCATCGGTTCCCGGCGGCGTGCAGCCCAAACGGCGGAAGCCAATTTATCTCAGTTGACCTCGAATCAG

>D1D2 sequence for MYA-3864

CTTAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCCCCCAGGCCCGAGTTGTAATTTGCAGAGGAAGCTTTTGGCGAGGCGCCTTCCGAGTTCCCTGGATACGGGACGCCATAGAGGGTGAGAGCCCCGTACGGTCTGGTGCCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCTAAATGGGAGGTAAACTCCTTCTAAAGCTAAATACTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGAGTTAAAAAGCACGTGAAATTGTTGAAAGGGAAGCGCTTGTGACCAGACTTGCGCCTGGCAGCTTAGCCGTCCTTCTGGGCGGTGTACTCTGCCGGCTCAGGCCAGCATCAGTTTCGGGCAGGGGAGAAATGCGGCGGGAATGTGGCTCTTCGGAGTGTTATAGCCCGCTGTTATGCCCTGCCGGGGACTGAGGTTCGCGCTCTGCACGGATGCTGG

Name of Depositor HP Molitoris
Special Collection ATCC
Chain of Custody
ATCC <-- HP Molitoris