Ogataea polymorpha (Morais et Maia) Yamada, Maeda et Mikata (ATCC® MYA-3665)

Strain Designations: NRRL Y-27863  /  Product Format: frozen

Deposited As Candida thermophila
Strain Designations NRRL Y-27863
Application
Biomedical Research and Development Material
Biosafety Level 2

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format frozen
Type Strain no
Preceptrol® no
Comments
Susceptibility to anti-fungals
Medium ATCC® Medium 200: YM agar or YM broth
Growth Conditions
Temperature: 30.0°C
Sequenced Data
>ITS of ATCC MYA-3665 TTTCCGTAGGTGAACCTGCGGAAGGATCATTACAGTATTCTTCTAAGCTGGAGCTGCTGATCGACTGAACTGTTTGCCTGCGCTGCTGAAATATTGCGTGCGCGGCGATGGTTTTTTTGGTTGCAGTTCTACTCAAGGCTTAGAAATCTCCTTACACACTTTGTTTTCTTATTAGAGACAAATTTGCTTTGGCTAGCGGTCGCTTAAGCGCGGCATGGCTGGCCAGAGGTTTTAACAAAACTCATTTTCGTCTTGCCCATGTGGGGAAGACTGAAAACTTGTATTATGATTTTGTCAGTTATAAGAAGTTGCGTTTGCAGCTTTTCTAAACTTCAAAACTTTCAACAACGGATCTCTTGGTTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGATTTTCGTGAATCATTGAATCTTTGAACGCACATTGCGCCCTCTGGTATTCCAGAGGGCATGCCTGTTTGAGCGTCATTTCCCTCTCAAACCCTCGGGTTTGGTGATGGGCAATACTCTCTTTTCTGAGAGTTTGCTTGAAATGAATTGGCATGAGTTTTTGATACGAACTTCAGCTGTTTATTCAATGTATTAGGTTTTATCCATCGTTGATTGACAACTGCAAGCTTCTTTCAAAAATTGGCTCTGCCTTACAAACTTTAATCATAAAGTTTGACCTCAAATCAGGTAGGATTACCCGCTGAACTTAAGCATATCAAT

//

>D1/D2 region of LSU rDNA of ATCC MYA-3665

ATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCTTAGTAGCGGCGAGTGAAGCGGCAAGAGCTCAAATTTGAAATCTGGTACCTTCGGTGCCCGAGTTGTAATTTGAAGAAAGCTATCTTGGAGGTGGCCCTTGTCTATGTTCCTTGGAACAGGACGTCATGGAGGGTGAGAATCCCGTGTGATGAGGTGTCCATTTCCGTGTAAGATGCTTTCGAAGAGTCGAGTTGTTTGGGAATGCAGCTCAAAGTGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAGAGACCGATAGCGAACAAGTACTGTGAAGGAAAGATGAAAAGAACTTTGAAAAGAGAGTGAAAAAGTACGTGAAATTGTTGAAAGGGAAGGGTATTTGATCAGACTTGGTATTTAGCTATCATCGCTCCTTGTGGGTGGTGCTCTAGCTTTTTACTGGGCCAGCATCAGTTTTGGTGGCAAGATAATGACAGTTGAATGTGGCTCCTCGGAGTGTTATAGCTTCTGTTGATGTTGCCTACCGAGACTGAGGTCTGCGGCTTTTGCCTAGGATGCTGGCGTAATGATCCAATACCGCCCGT

//

Name of Depositor X Zheng
Special Collection NSF - Mycology
Chain of Custody
ATCC <-- X Zheng
Isolation
blood, Chicago, Illinois, USA
Cross References

Nucleotide (GenBank) : FJ914938 D1/D2 region of 28S rRNA gene

Nucleotide (GenBank) : FJ914921 ITS including 5.8S rRNA gene

References

Bar-Meir M, et al. Catheter-related fungemia due to Candida thermophila. J. Clinic. Microbiol. 44: 3035-3036, 2006.

Suh SO, Zhou JJ. Methylotrophic yeasts near Ogataea (Hansenula) polymorpha: a proposal of Ogataea angusta comb. nov. and Candida parapolymorpha sp.nov. FEMS Yeast Res. 10: 631-638, 2010. PubMed: 20491937