Beauveria bassiana (Balsamo) Vuillemin (ATCC® 90519)

Strain Designations: NRRL 20700  /  Product Format: freeze-dried

Deposited As Beauveria bassiana (Balsamo) Vuillemin
Strain Designations NRRL 20700
Application
Produces chymoelastase
Produces chymotrypsin
Produces endochitinase
Produces esterase
Produces hexosaminidase A (alpha polypeptide) Hexose aminidase A (alpha polypeptide), beta-N-acetylhexosaminidase, N-acetyl-beta-glucosaminidase
Produces trypsin
Degradation of insect cuticles
Biosafety Level 1

Biosafety classification is based on U.S. Public Health Service Guidelines, it is the responsibility of the customer to ensure that their facilities comply with biosafety regulations for their own country.

Product Format freeze-dried
Storage Conditions Frozen: -80°C or colder
Freeze-Dried: 2°C to 8°C
Live Culture: See Propagation Section
Type Strain no
Preceptrol® no
Sequenced Data
18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

AGGGATCATTACCGAGTTTTCAACTCCCTAACCCTTCTGTGAACCTACCTATCGTTGCTTCGGCGGACTCGCCCCAGCCCGGACGCGGACTGGACCAGCGGCCCGCCGGGGACCTCAAACTCTTGTATTCCAGCATCTTCTGAATACGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAACGCGATAAGTAATGTGAATTGCAGAATCCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACCTCCCCTTGGGGAGGTCGGCGTTGGGGACCGGCAGCACACCGCCGGCCCTGAAATGGAGTGGCGGCCCGTCCGCGGCGACCTCTGCGCAGTAATACAGCTCGCACCGGAACCCCGACGCGGCCACGCCGTAAAACACCCAACTTCTGAACGTTGACCTCGAATCAGGTAGGACTACCCGCTGAACTTAAG


D1D2 region of the 28S ribosomal RNA gene

CATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGCGAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCAGGGCCCGAGTTGTAATTTGTAGAGGATGCTTTTGGCGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCCACAGAGGGTGAGAGCCCCGTATGGTCGGACACCGAGCCTCTGTAAAGCTCCTTCGACGAGTCGAGTAGTTTGGGAATGCTGCTCAAAATGGGAGGTATATGTCTTCTAAAGCTAAATATTGGCCAGAGACCGATAGCGCACAAGTAGAGTGATCGAAAGATGAAAAGCACTTTGAAAAGAGGGTTAAAAAGTACGTGAAATTGTTGAAAGGGAAGCGCCTATGACCAGACTTGCGCCCGGTGAATCACCCAGCGTTCTCGCTGGTGCACTTTGCCGGGCACAGGCCAGCATCAGTTCAGCGCGGGGGAGAAAGGCTTCGGGAATGTGGCTCCCTCGGGAGTGTTATAGCCCGCTGCGTAATGCCCTGCGCCGGACTGAGGTACGCGCATTGCAAGGATGCTGGCGTAATGGTCATCAGCGA

Name of Depositor NRRL
Isolation
Japanese beetle
References

Gupta SC, et al. Insect cuticle-degrading enzymes from the entomophagous fungus Beauveria bassiana. Exp. Mycol. 16: 132-137, 1992.